... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . Registration . ... Edit registration info . ... Registration fee Pontryagin 2008 Conference, YOUR NAME . ... Most often you will need to indicate the intermediary bank (or Correspondent Bank) which is used to make an international transaction. ...

Еще в разделе: (Показать все результаты (>59) - pont2008.cmc.msu.ru/ )

• Program International Conference Differential Equations and Topology dedicated
• On mathematical creative work of L.S. Pontryagin (By D.V. Anosov) International
• Links International Conference Differential Equations and Topology dedicated to

... About CIE MSU . ... Student's Life . ... Vestnik CIE (in Russian) . ... About Moscow University . ... Life . ... Students life in personal extracts presented to us by one of our students. A Normal Day, 30 Nov 2004, 11.20pm (Moscow time) . ... Since school always begins at 10am, my alarm-clock starts its attempts to wake me at 08.40am. ... But to get in time to the university I cannot sleep more then these ten extra minutes. ... As usual, I try to make all morning routines as regular as possible. ...

Еще в разделе: (Показать все результаты (>280) - www.cie.ru/ )

• Russian Language Programmes :: Academic Programmes :: CIE
• Admissions :: CIE
• Center for International Education - News Archive

QUANTUM STOCHASTIC PROCESSES This course is for 4-5th year and graduate students. ... It is dedicated to systematic account of Quantum Stochastic Processes right in the form they are actually used in theoretical calculations of Quantum Open Systems. ... LECTURE 2. ... Open systems and quantum stochastic processes. Mathematical definition of an open system and quantum stochastic process. ... Markovian quantum stochastic processes. Formal definition of quantum markovian stochastic process. ...

Еще в разделе: (Показать все результаты (>96) - qilab.phys.msu.ru/ )

• Quantum Information Lab, Int'l Laser Ctr. and Faculty of Physics, M.V.Lomonosov

... Форумы > Аспирантура > Тема . ... Аспирантура в Англии по машинному обучению . Если Вас интересует аспирантура в Англии по теме 'Машинное обучение' (с большим весом математических методов: функциональный анализ, теория вероятностей,...), пожалуйста свяжитесь со мной: vovk@cs.rhul.ac.uk (Владимир Вовк). ... Название проекта, в рамках которого ищется аспирант, - 'Practical competitive prediction' (funded by EPSRC). ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>228) - www.mmonline.ru/ )

• MI RAN, Alexeyev Conference, 23-28 December
• MMOnline | Форумы | Преподаватели | А.Т. Фоменко
• MMOnline | Новости | MI RAN, Alexeyev Conference, 23-28 December

IMAGE SUPER-RESOLUTION USING FAST DECONVOLUTION A. Krylov2, A. Nasonov3, O. Ushmaev 2 4 1 Faculty of Computational Mathematics and Cybernetics, Moscow Lomonosov State University ... Informatics problems of the Russian Academy of sciences, 119333, Russia, Moscow, Vavilova, 44, 2, (499) 135-62-60, olegu@bliolink.ru Super-resolution problem is posed as an inverse deconvolution problem ... Hybrid method to suppress the problems of warping operator inaccurate determining is under work. ...

Еще в разделе: (Показать все результаты (>171) - imaging.cmc.msu.ru/ )

• Research | Laboratory of Mathematical Methods of Image Processing
• Software projects | Laboratory of Mathematical Methods of Image Processing

Theory as a Lighthouse in the Electrochemical Ocean . In memory of Alexander M. Kuznetsov . ... Until his last days he continued to work on various aspects of charge transfer phenomena. ... In electrochemical kinetics the theory always outruns the experiment, and the quantum mechanical theory of charge transfer created in the famous Theoretical Department of the Frumkin Institute in Moscow (R.R. Dogonadze, A.M. Kuznetsov and co-authors) is a good example for that. ...

Еще в разделе: (Показать все результаты (>60) - electr003.chem.msu.ru/ )

... Development of a computer-based information system for Russian folklore studies . Computer systems SKAZKA and SKAZKA-2 are developing by A.V. Rafaeva. The aim of this work is to make program tools for structural analysis of folktale plots and motives. ... 112 – 113; Rafaeva A.V. Analiz rodstvennykh otnoshenij s pomosh’ju sistemy SKAZKA (Analysis of Relate Terms with the Help of SKAZKA Program) // Problemy kompjuternoj lingvistiki: Sbornik nauchnykh trudov, 1. ...

Еще в разделе: (Показать все результаты (>25) - lcl.srcc.msu.ru/ )

Curriculum Vitae . ... Lomonosov Moscow State University , Faculty of Computational Mathematics and Cybernetics . ... Lomonosov Moscow State University , Faculty of Physics . ... 2010 - till now . ... Research Scholar . ... Scholarship supporting perspective young scientists and teachers of Lomonosov Moscow State University who achieved significant results in teaching and research . ... Kurchatov Scholarship for excellent students of the Faculty of Physics, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>14) - oc.cs.msu.ru/ )

... 17, No. 10 (2007) 3603­3606 c World Scientific Publishing Company STABILIZATION OF CHAOTIC BEHAVIOR IN THE RESTRICTED THREE-BODY PROBLEM ARSEN DZHANOEV and ALEXANDER LOSKUTOV Physics Department, Moscow State University, Leninskie Gory, Moscow 119992, Russia janoev@pol ly.phys.msu.ru Loskutov@chaos.phys.msu.ru Received Octob er 19, 2005; Revised February 20, 2006 The restricted three-bo dy problem on the example of a perturbed Sitnikov case is considered. ... The Sitnikov problem. ... Fig. ...

Еще в разделе: (Показать все результаты (>78) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/Letter_to_editor.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/PHDK634.pdf
• Research interests

DNS Security, Stability and Resiliency John Crain Chief Technical Officer April 21st 2009 Garmisch 1 Monday, 20 April 2009 Agenda · The Global DNS SSR Symposium · Problems and Opportunities · Questions? ... The level of awareness with respect to the DNS is very low" ­ All quotes from Symposium Report 7 Monday, 20 April 2009 Problems & Opportunities 8 Monday, 20 April 2009 Problem: · There is a need for training across all sectors of the industry to raise both skills and awareness. ...

Еще в разделе: (Показать все результаты (>14) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc

... The analysis shows, that asteroid ­ rubble pile loses its fast fragments in no time but the retaining fragments forms a compact structure immersed in dust ­ gas atmosphere, created by interaction of interplanetary medium with dispersed product of collisional evolution of asteroid. By interaction of an asteroid ­ rubble pile with interplanetary medium structures asteroid can increase its brightness on account of blowed up dust simulating phenomenon of distant comet's brightening. ...

Еще в разделе: (Показать все результаты (>85) - selena.sai.msu.ru/ )

• Problem 2000
• Санович А.Н.
• Anatoly N. Sanovich

Laboratory of Systems for Automated Image Processing . ... Development of efficient methods for solving inverse problems of x-ray and wave tomography . ... Wave Tomography . ... The methods of solving inverse problems as coefficient inverse problems can provide information about the internal structure of the object even in the case of limited data tomography. ... One of the main challenges faced by ultrasonic tomography is the development of mathematical methods for solving inverse problems. ...

Еще в разделе: (Показать все результаты (>158) - srcc.msu.ru/ )

• A.V. Setukha. The singular integral equation method in a 3-d boundary problems
• V.A. Morozov. Regularization Methods for Ill-Posed Problems
• Gol'dman N. L. Inverse problems with final overdetermination for parabolic

Online Services | ... Nuclear Wallet Cards" . USA National Nuclear Data Center - NNDC . ... Nuclei Selection: . All nuclei Only even Only odd . ... Decay Type: . decay . ... CDFE Head: Vladimir V. Varlamov . ...

Еще в разделе: (Показать все результаты (>44) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Nucleus Ground State Parameters
• CDFE - Centre for Photonuclear Experiments Data - Home page
• CDFE => Online Services => Relational ENSDF

... Individual SELEX products, aptamers, are small molecules (40­100 nt) that have a unique three-dimensional structure, which provides for their specific and high-affinity binding to targets varying from low-molecular-weight ligands to proteins. ... Selection of aptamers binding with a target is the key step in SELEX, as aptamers account for only a small fraction of the initial library (one aptamer per 109 to 1013 molecules) [6]. ... Fourth, modification can increase the aptamer affinity for a target. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

Dmitriy Mendeleev . ... Dmitry Ivanovich Mendeleev : A project of undergraduate students from School No.470 (St.Petersburg) . ... Brokhaus Online: Biography of Mendeleev in Russian . ... Original Periodic Table by Mendeleev . ... Mendeleev's "Principles of Chemistry" (4 Pts. in 2 Vols) . ... Mendeleev's house museum in the village Boblovo, Moscow region (in Russian) . Statue of Mendeleev in front of Chemistry Department at Moscow State University (from the article about Russian chemistry in Chem. ...

Еще в разделе: (Показать все результаты (>123) - www.chem.msu.ru/ )

• Mathematical Chemistry
• Scientific conference Women in chemistry: biographical portrait, contribution
• Intuitive Chemical Topology Concepts

.. , . . , . , (e-mail: safonov@ulstu.ru) , , , crisis of the media, manipulation of consciousness, people and information . , . . The article is devoted to the problem of relationship between massmedia and auditorium. It is assumed that the very relationship went into deep crisis which seems to be becoming more sensitive. The author analyses the causes of the crisis and makes proposals to its solution.

Еще в разделе: (Показать все результаты (>79) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2014/4/10.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/2/06.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2015/1/11.pdf

Mailing List . Discussion club . Unresolved problems in the Study of Nature and Evolution of Human Language . ... Our goal is to consider some interesting and still unresolved problems of general theory of Human Language. ... Regularities of Human Language Evolution”. ... Universal, typological and stylistic features of Human Language Evolution; . ... Large Explanatory Dictionary of Russian (SPb: Norint, 1998. - 1536p.): preliminary evoluation of the dictionary (Russian letter "X") . ...

Еще в разделе: (Показать все результаты (>62) - old.philol.msu.ru/ )

• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics
• TRUE WRITER RECOGNITION
• HumLang - Useful Links for linguists

... Russian: ps 2 pages . Published in: Russian Math. Surveys 57 (2002), no.3. ... English: ps (gzipped) 41 pages . ... Finitely presented groups and semigroups in knot theory. Russian: ps (gzipped) tex . English: ps (gzipped) tex . ... Russian: ps (gzipped) English: ps 20 pages . arXiv.org e-Print archive: http://arXiv.org/abs/math.RA/0205042 . ... Russian: ps English: ps 11 pages . ... In this paper we introduce and study gauge-equivariant $K$-theory groups $K_\GR^i(Y)$. ...

Еще в разделе: (Показать все результаты (>187) - higeom.math.msu.su/ )

• Conferences (English)
• Publications (Russian)
• Links (Russian)

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>10) - math.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus
• Align tool for DNA-protein complexes