. My present-day life in photos . Carnivals . I like to visit the region . where I was born . Museums . Our picnics in Moscow Region . My lectures . Scientific events . Photo portraits . Walks in forest . My colleagues and friends . With Prof. M.Feigenbaum . My hobby . My friend Andrei Isaev . Dacha of Vadim Anischenko, Volga river . With Vered Rom-Kedar, Israel . My friends abroad . With Kolya Brilliantov, . my friend

Еще в разделе: (Показать все результаты (>110) - chaos.phys.msu.ru/ )

• Staff

... О компании Dow . ... Ссылки на Dow или Компанию означают компанию Dow Chemical (The Dow Chemical Company) и ее консолидированные дочерние компании, если намеренно не указано иное. ... О компании Dow в России и СНГ . ... В настоящее время компания Dow проводит набор кандидатов для Программы развития коммерческих навыков (Commercial Development Program). ... Ability to learn and understand the critical technical, commercial and business features related to the products they will have to sell . ...

Еще в разделе: (Показать все результаты (>104) - www.physcareer.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

О факультете . ... 15 марта 2016 года декан биологического факультета Михаил Петрович Кирпичников стал лауреатом премии имени А. А. Баева. ... 27 марта 2016 года, в рамках общеуниверситетского дня открытых дверей, прошел день открытых дверей на биологическом факультете. ... 11- 15 апреля 2016 года на Биологическом факультете пройдет конференция Ломоносов-2106, секция Биология. ... Срок обучения на биологическом факультете в бакалавриате 4 года, в магистратуре 2 года. ... Биологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>12) - www.bio.msu.ru/ )

Cell Biology International 27 (2003) 293­294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...

Еще в разделе: (Показать все результаты (>36) - cellmotility.genebee.msu.ru/ )

... DRIVER: Using the regional climate model COSMO-CLM for detailed climate changes simulation in the European part of Russia, Arctic, tropical zone etc. STRATEGY: Global climate models don't allow to assess climate changes features on the regional scales reliably. ... IMPACT: Advance in the regional climate modeling quality (European part of Russia, Arctic, tropical zone) at the expense of using the regional model COSMO-CLM. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• APPLICATIONS: Optics and Quantum Electronics | Moscow University Supercomputing
• Welcome to HPC.MSU.RU! | Moscow University Supercomputing Center

The Chair of Mathematical Theory of Intelligent Systems and . ... Staff . ... Safiullin A.N. was born on the 27th of March, 1979 in Riga, Latvia. ... Since January 2003 Safiullin A.N. has been working as a Junior researcher of the Chair of Mathematical Theory of Intelligent Systems (MaTIS) of the Department of Mathematics and Mechanics of the Lomonosov Moscow State University. ... The Chair of Mathematical Theory of Intelligent Systems, Laboratory of Problems of Theoretical Cybernetics . ...

Еще в разделе: (Показать все результаты (>106) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Интеллектуальные системы :: Наука :: :: V international congress on

Roman Sutormin rsutormin@gmail.com Professional experience 05/2013 ­ present: Lawrence Berkeley National Laboratory (Berkeley, CA, USA) Software developer Development of JSON based storage system used for keeping biological data involved in public KBase services. ... 10/2009 ­ 08/2011: Mail.Ru Group (Moscow, Russia), Software developer Support and development of data warehouse (PostgreSQL) and administration web tool (JBoss + GWT) on serverside of MMO game "Allods Online". ... 2013 Jul 1514(1):476. ...

Еще в разделе: (Показать все результаты (>13) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2013.pdf

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>75) - mouse.belozersky.msu.ru/ )

... Publications . ... Laboratory of Mathematical Methods of Image Processing . ... Diffuse axonal injury lesion segmentation using contouring algorithm . ... This study is devoted to semiautomated segmentation of DAI lesions on T2*-weighted brain magnetic resonance (MR) images. ... A proposed algorithm for automated segmentation of DAI lesions inside specified regions is based on contouring algorithm which treats the image as a 3D topological map where a pixelтАЩs intensity corresponds to its height. ...

Еще в разделе: (Показать все результаты (>622) - imaging.cmc.msu.ru/ )

• Laboratory of Mathematical Methods of Image Processing
• Publications | Laboratory of Mathematical Methods of Image Processing

... INFORMATICS AND MANAGEMENT: BOLOGNA-STYLE QUALIFICATIONS FRAMEWORKS (INARM) . ... Lomonosov Moscow State University, Faculty of Computational Mathematics and Cybernetics (CMC MSU) . ... 2013, February, Kick-off meeting in Lublin. ... 2013, June, Coordinating meeting at CMC MSU, Moscow. ... 2013, October, Coordinating meeting at CMC MSU, Moscow. ... 2013, December 19, Webinar and coordinating meeting at CMC MSU, Moscow. 2013, December 27, Coordinating meeting at CMC MSU, Moscow. ... CMC MSU ? ...

Еще в разделе: (Показать все результаты (>260) - en.cs.msu.ru/ )

• International project INARM of EU program Tempus-IV
• International Scientific Conference "Probability Theory and its Applications"

Unity in the name of the Higher School I.B. Fedorov, Chairman of Rectors' Council of Moscow and Moscow Region, Rector of Moscow State Bauman Technical University, Corresponding Member of Russian Academy of Sciences. ... They help to think anew those events, which are still extremely important many years later. ... Even more, inside the higher school itself, skeptical mood prevailed at that time - just another senseless organization to waste time and efforts. ...

Еще в разделе: (Показать все результаты (>81) - www.rsr-online.ru/ )

• Structure
• GAFUROV ILSHAT RAFKATOVICH

International Laser Center of MSU . ... Laser Graduate School . ... 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . Moscow Vyatichi, November 9 - 11, 2009. ... XIII International School for Junior Scientists and Students . ... Second International Laser Graduate School (LGS) Modern Problems of Laser Physics dedicated to the 80th anniversary of academician R.V. Khoklov will be held on October 10-13, 2006 at Educational Center "Vyatichi", Moscow Region. ...

Еще в разделе: (Показать все результаты (>771) - ilc.phys.msu.ru/ )

• LGS-06
• Scientific conference
• Конференции

95. RELEC Mission: Relativistic ELECtron Precipitation and TLE Study on-board Small

96. http://tunka.sinp.msu.ru/en/presentation/Khrenov.pdf

97. http://rnp-group.genebee.msu.su/pdfs/febsz.pdf

98. адрес МГУ, чтоб поняли за границей - Public forum of MSU united student...

99. http://nanolab.phys.msu.ru/sites/default/files/dd15_shilkin.pdf

100. Качество структуры - учебный сайт Смирновой Виктории