Home Search Collections Journals About Contact us My IOPscience The role of scattering on atomic nucleus and of electron state entanglement in single ionization of He by ion impact This article has been downloaded from IOPscience. ... In inelastic scattering, due to the orthogonality of one-electron states, the transitions of different electrons are summed in the amplitude with all other electrons non-active. ... Chem. 45 125. where fppf is the ordinary amplitude of elastic scattering. ...

Еще в разделе: (Показать все результаты (>124) - danp.sinp.msu.ru/ )

... Building Galaxies in the Early Universe . ... Explanation: What was the very early universe like? To help find out, astronomers pointed the Hubble Space Telescope between bright nearby objects to create one of the deepest images ever -- the Hubble Ultra Deep Field (HUDF). ... A recent analysis of the HUDF focused on the smallest, faintest and most compact galaxies imaged. ... Publications with keywords: galaxies - early universe . Publications with words: galaxies - early universe . ...

Еще в разделе: (Показать все результаты (>16133) - www.astronet.ru/ )

• Астронет > Building Galaxies in the Early Universe
• Journal "Peremennye Zvezdy"
• Full Moon Crossing

RUSSIAN PEREPLET . Culture, Science, and Education Portal . Science Space Culture General Discussion Scientific Discussion Seminars . News: The best of Russian Science and Technology . ... MASTER Team Science Release: Discovery of the Black Hole Ergosphere? ... The International Conference "The International Conference" . ... MASTER is the first russian asteroid factory . ... New Russian "Volga" . ... MASTER - is the first russian robotic telescope for observations Gamma-Ray Bursts . ...

Еще в разделе: (Показать все результаты (>173) - www.pereplet.ru/ )

In memory of Sasha Kuznetsov . Only two days ago I came back from a visit abroad to the sorrowful news that our long-time good colleague and friend, a sparkling and noble personality, Alexander Mikhailovitch Kuznetsov, to me and many others, Sasha, had passed away. ... This applied both to his own realm of molecular charge transfer phenomena but also in his interests in broader areas of condensed matter chemical physics. ... Sasha enjoyed high and increasing international respect. ... Back ...

Еще в разделе: (Показать все результаты (>97) - electr003.chem.msu.ru/ )

• Elena V. Stenina:CV
• Liana N. Sviridova:CV

Cameras · ­ · · · · · · · · ! MATLAB · MATLAB · Let's design a camera Idea 1: put a piece of film in front of an object Do we get a reasonable image? ... Slide by Steve Seitz Shrinking the aperture Adding a lens A lens focuses light onto the film · Thin lens model: ­ Rays passing through the center are not deviated (pinhole projection model still holds) Slide by Steve Seitz Adding a lens focal point f A lens focuses light onto the film · Thin ...

Еще в разделе: (Показать все результаты (>22) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2013.PRIA.Mamaev_Lukin_Yurin.HermiteNLM.en.pdf
• http://imaging.cs.msu.ru/pub/2013.PRIA.Levashov_Yurin.RidgeAndTree.en.pdf
• http://imaging.cs.msu.ru/files/courses/ipintro2012/Lec_Pt3_inpaint_my.pdf

SVETKA, a program for analysis of different alignments . Back to the help page . ... Such a feature can look like " Leucine in the position 362 of the alignment of the entire family " and can, in many cases, be a "decision rule" to distinguish sequences from two sides of a tree branch. ... Comparing the alignment with an input tree (the tree may be entered by the user or reconstructed with the WPGMA algorithm), the program detects supporting positions of the alignment for every branch the tree. ...

Еще в разделе: (Показать все результаты (>884) - monkey.belozersky.msu.ru/ )

• ETS_3D_conservation
• About authors ot this complex

... MCCME, Moscow 3 papers and (a) English edition of the textbook "Probability", vol. ... Springer, Berlin, 2006. ... 4 C. Conferences (as a participant): · Plenary talk at the Conference on Probability Theory and Mathematical Statistics dedicated to the centenary of A. N. Kolmogorov (September 21­27, 2003, Tbilisi, Georgia); · Plenary talk at the Franco- Russian Colloquium Perspectives de coopґ ation en informatiques et mathґ er ematiques appliquґ ees (October 2003, Moscow ); · Plenary ...

Еще в разделе: (Показать все результаты (>167) - new.math.msu.su/ )

• Mikhail Ilych Zelikin | Department: General Problems of Control. Faculty of
• Andrei Vladimirovich Fursikov | Department: General Problems of Control.
• Silaev Dmitrii Alekseevich | Department: General Problems of Control. Faculty

General Information . ... We'd like to announce the forthcoming IAU Conference: . ... A conference organized by Sternberg Astronomical institute (Moscow, Russia) and Working group "Site-testing Instruments" of the International Astronomical Union on various aspects of site-testing techniques, approaches and results. RUSSIA, Kislovodsk (Caucasus Mineral Waters region), 4-9 October 2010. ... Victor Kornilov, Sternberg Astronomical Institute . ... 3-4 October: Registration and accommodation . ...

Еще в разделе: (Показать все результаты (>30) - site2010.sai.msu.ru/ )

• Results of ELT site testing programs - II

Book Review Struct Multidisc Optim 28, 372 ­ 373 (2004) DOI 10.1007/s00158-004-0451-7 A.P. Seyranian and A.A. Mailybaev: "Multiparameter Stability Theory with Mechanical Applications" World Scientific Publishing Co. ... A remarkable feature of the book is the authors' presentation of a new multiparameter bifurcation theory of eigenvalues, which is a key point for the stability and instability studies. ... The material of the book is organized into 12 chapters. ...

Еще в разделе: (Показать все результаты (>30) - mailybaev.imec.msu.ru/ )

• Multiparameter Stability Theory with Mechanical Applications
• Book review by Professor Wolfhard Kliem
• Curriculum Vitae of Dr Alexei A

О лаборатории . ... Лаборатория теоретической биофизики . Published in Февраль 8th, 2016 . Posted by comcon1 in Без рубрики . ... ERG group members work with different types of molecules and consequently added new atomtypes into classical OPLS-AA distributed with GROMACS. Now the ERG patch of OPLS-AA force field is published at bitbucket as a repository. continue reading.. ... Published in Май 19th, 2015 . ... comcon1 in All-atom automatic OPLS-AA topology? . ... 2014 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>57) - erg.biophys.msu.ru/ )

• Building and plotting Fukui function with FireFly and PyMol ERG Research Group:
• pymol ERG Research Group: Лаборатория теоретической биофизики
• Firefly ERG Research Group: Лаборатория теоретической биофизики

... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...

Еще в разделе: (Показать все результаты (>41) - nanofluidics.phys.msu.ru/ )

... Nonlinear fiber optics . ... member of the Editorial Board for the Laser Physics journal . ... Member of the steering committee of the international conference on Raman spectroscopy (ICORS): Budapest, 2002; Brisbane, 2004; Yokohama, 2006; London, 2008 . Member of the steering committee of the International Laser Physics workshop: Bratislava, 2002; Hamburg, 2003; Trieste, 2004; Kyoto, 2005; Lausanne, 2006; Leon, 2007; Trondheim, 2008; Barcelona, 2009 . ... International conference ?Laser Optics? ...

Еще в разделе: (Показать все результаты (>46) - photonicslab.phys.msu.ru/ )

V.A. Khokhlova, M.R. Bailey, P.J. Kaczkowski, B.W. Cunitz, J. Reed, M. Nakazawa, and L.A. Crum. ... V.A. Khokhlova. ... O.A. Sapozhnikov, R. Cleveland, M.R. Bailey, L.A. Crum. ... V.A. Khokhlova, M.A. Averkiou, M.A. Bailey, and L. A. Crum. ... V.A. Khokhlova, P.J. Kaczkowski, B.W. Cunitz, M.R. Bailey, and L.A. Crum. ... In: Book of Abstracts of the, 3.32B. V.A. Khokhlova, M.A. Averkiou, A.E. Ponomaryov, L.A. Crum. ... A.E. Ponomaryov, V.A. Khokhlova, M.A. Averkiou, and L.A. Crum. ...

Еще в разделе: (Показать все результаты (>64) - acoustics.phys.msu.ru/ )

• A.V.Shanin

ELENA ROVENSKAYA RUSSIAN . ... Optimization and optimal control, dynamic systems, mathematical modeling in economics and ecology . ... Elena Rovenskaya's research aims at the theoretical elaboration of new methods for solving optimal control problems (both analytical and numerical), as well as at application of existing methods to solve economic, social and ecological problems. ... 2009) Rovenskaya E.A. To the Solution of an Optimal Control Problem with State Constraints by Doubled-variations Method. ...

Еще в разделе: (Показать все результаты (>15) - oc.cs.msu.ru/ )

... Berezhnoi A.A., Klumov B.A., Shevchenko V.V., Fortov V.E. Collision of a comet with Jupiter: Determination of fragment penetration depths from the molecular spectra, JETP Letters, V. 63, No. 6, p. 405-410, 1996 . ... Berezhnoi A.A., Klumov B.A., Shevchenko V.V., Fortov V.E. Shock chemistry in Jovian atmosphere following SL9 impacts, International Conference on the SL9-Jupiter Collision, I-2, July 3-5, 1996, Meudon, France . ... Berezhnoi A.A., Klumov B.A. Lunar ice: Can its origin be determined? ...

Еще в разделе: (Показать все результаты (>134) - selena.sai.msu.ru/ )

• Comment on the International Jubilee Symposium
• Vladislav V. Shevchenko
• Geophysical Research Abstracts

... The Council on Complex Problems of Cosmic Rays of the Russian Academy of Sciences and the Skobeltsyn Institute of Nuclear Physics (SINP) of Lomonosov Moscow State University are planning to held a workshop "Cosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century" on May 16-18 2011 at the Moscow State University. ... The Workshop banquet will be held on Tuesday, May 17 th . ... Workshop тАЬCosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century"...

Еще в разделе: (Показать все результаты (>8) - tunka.sinp.msu.ru/ )

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ...

Еще в разделе: (Показать все результаты (>7) - ani.cs.msu.su/ )

• Alexander Pozdneev at the SIAG/LA-SIMUMAT International Summer School on
• Prof. Dmitry P. Kostomarov at the Differential Equations and Topology...
• Alexander Pozdneev at the ASMS 2008 Conference

... about ERC . education . research . events . ... Being an effective way of acquiring knowledge, they also make a good addition to core lecture courses and involve students, postgraduates and scientists of other Russian higher education institutions and research centers in ERC activity in the initial stage. ... More information can be found at http://polly.phys.msu.ru/ru/unc/sconf.html . ... Conference on Development Prospects of Education and Research Centers in the Russian Federation . ...

Еще в разделе: (Показать все результаты (>56) - nano.msu.ru/ )

• The 7th International Nanoscience Student Conference, London, 19?22 August 2013
• Statutes of the MSU Nanotechnology Education and Research Center | MSU
• Forthcoming seminars. Prospective Nanomaterials | MSU Nanotechnology Education

... Rete 1. Forgy, Charles L. "Rete: A Fast Algorithm for the Many Pattern/Many Object Pattern Matching Problem." Artificial Intelligence, Vol. 19, ? ... Proceedings of the Fifth National Conference on Artificial Intelligence, AAAI, Philadelphia, 1986, pp. ... Scales, D. "Efficient matching algorithms for the SOAR/OPS5 production system." ... Proceedings of the Sixth IEEE Conference on Artificial Intelligence Applications, 1990, pp. ... TREAT: a better match algorithm for AI production system." ...

Еще в разделе: (Показать все результаты (>149) - sp.cs.msu.ru/ )

• Development of portable program system
• Explicit cyclic schemes for space neutron kinetics in (Hex-Z) geometry
• DVM-system. Goals and structure

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )