Projects . ... Modeling the tmRNA structure in the ribosome . For modeling of the tmRNA-2 structure in the ribosome we used the published ribosome X-ray structure with a defined mRNA path (Yusupova et al, 2006). ... Since the arch consisting of tmRNA pseudoknots and helices was observed by cryo-EM in the pre-initiation complex (Valle et al, 2003) as well as in the tmRNA-4 complex described here, we suggest that such a structure should be present at all steps of the tmRNA path through the ribosome. ...

Еще в разделе: (Показать все результаты (>37092) - dualopt1.cmm.msu.ru/ )

Network Working Group Request for Comments: 2992 Category: Informational C. Hopps NextHop Technologies November 2000 Analysis of an Equal-Cost Multi-Path Algorithm Status of this Memo This memo provides information for the Internet community. ... The analysis includes the performance of the algorithm and the disruption caused by changes to the set of next-hops. ... The N next-hops have been assigned unique regions in the key space. ... For this analysis we will assume regions of equal size. ...

Еще в разделе: (Показать все результаты (>18763) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2992.txt
• http://mirror.msu.net/pub/rfc-editor/internet-drafts/draft-kklf-sidr-route-server-rpki-light-00.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1216.txt

... 106 ї иЫУ,НЛМ е.а., 1996 лйкйлйЗлдав йЕкДбйЗДнЦгъзхв ЬмкзДг, <10, 1996 2. щооЦднх лйгзЦузйв а еДЙзанзйв ДднаЗзйлна З ЗДкаДсаьп лдйкйлна сакдмгьсаа заЬзЦв ДнейлоЦкх . 1 1775 1982 . ... имСйЗдаз е.а. ЗгаьзаЦ лйгзЦузйв ДднаЗзйлна зД лйлнйьзаЦ заЬзЦв ДнейлоЦкх а ийЙйСм 107 , . ... имСйЗдаз е.а. ЗгаьзаЦ лйгзЦузйв ДднаЗзйлна зД лйлнйьзаЦ заЬзЦв ДнейлоЦкх а ийЙйСм 109 [11] , ( 6%) . ... T "" ( 1 ) - ( 2 ). имСйЗдаз е.а. ЗгаьзаЦ лйгзЦузйв ДднаЗзйлна зД лйлнйьзаЦ заЬзЦв ДнейлоЦкх а ийЙйСм 111 , . ...

Еще в разделе: (Показать все результаты (>136) - www.kosmofizika.ru/ )

• http://www.kosmofizika.ru/buri/geostorm.pdf
• Нейтроны и космическая погода, Кужевский и др.

A Cue-based Approach to the Acquisition of Grammatical Gender in Russian This paper aims at explaining a discrepancy in children's use of the semantic gender principle across some exceptional classes of Russian nouns in terms of a cue-based approach to acquisition. ... The results of elicited production experiments with 25 monolingual Russian children (age 2;6-4;0) presented in Rodina (2008) reveal that the semantic principle is least operative with hybrids and female names (see Figure 1). ...

Еще в разделе: (Показать все результаты (>405) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~rlc2010/abstracts/rlc2010_abstracts_sem25.pdf
• International Congress of Russian Language researches - preliminary program
• Speech rhythm in diachrony and synchrony

... Authors: Rodrigues da Silva et al. arxiv:1503.02649 Первые результаты наблюдений с высоким угловым разрешением области HL Tau на ALMA (First Results from High Angular Resolution ALMA Observations Toward the HL Tau Region) . ... Authors: Jaret Heise . arxiv:1503.03251 Светлое будущее фотометрии: обнаружение аналогов Солнечной системы с помощью будущих космических телескопов (Photometry's bright future: Detecting Solar System analogues with future space telescopes) . Authors: Michael Hippke . ...

Еще в разделе: (Показать все результаты (>434) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/1202.html
• http://xray.sai.msu.ru/~polar/sci_rev/1502.html

... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...

Еще в разделе: (Показать все результаты (>4) - vernov-relec.sinp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Available on CMS information server CMS NOTE 2000/065 The Compact Muon Solenoid Experiment Mailing address: CMS CERN, CH­1211 GENEVA 23, Switzerland CMS Note ``SingleTop'' ­ an event generator for the single top quark production at the LHC. ... But this process has sufficiently different signature which is similar to the top quark pair production signature. ... The events for the two main processes of the single top quark production at the LHC are available in the CMS processes data base PEVLIB [14]. ...

Еще в разделе: (Показать все результаты (>28) - top.sinp.msu.ru/ )

• http://top.sinp.msu.ru/lev/d0note_3612.ps

Nuclear Instruments and Methods in Physics Research B 230 (2005) 73-76 www.elsevier.com/locate/nimb Energy loss calculations for fast light ions in celluloid including charge -exchange processes Ya.A. Teplova *, Yu.A. Belkova, O.A. Yuminov D.V. Scobeltsin Institute of Nuclear Physics, Lomonosov State University, 119899 Moscow, Russia Available online 21 January 2005 Abstract A method is proposed to calculate the charge -exchange energy loss ( ... B 230 (2005) 73-76 ionic charge i0. ...

Еще в разделе: (Показать все результаты (>128) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Articles_GSIB/nimb206_842_Yamada_GCIB_modellingSmoothing.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb206_855_Yamada_B-ClasterIons.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb_GCIB_Ar_Smoothing_Swenson.pdf

... The study of adaptive variability, i.e. the study on the population level of the physiological adaptation of the human organism to a variety of environmental conditions, is the main purpose and the basic principle of physiological anthropology. ... Regional rates of hormonal activity of indigenous population of different ethno-territorial groups that we have elaborated broaden our notions about common conformities of age variability and aging and the reasons of these processes. ...

Еще в разделе: (Показать все результаты (>30) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_4.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

. [ Войти ] . Главная -> Фильмы -> The Limbic Region . Пользователи . Демо . Деньги . Фильмы . Форум . The Limbic Region . США 1996 . отметить . Триллер . Боевик .

Еще в разделе: (Показать все результаты (>296) - kinfo.ru/ )

• Gamera 2: Region shurai - Фильмы - Kinfo.ru
• Region-NetByNet-Western - Фильмы - Kinfo.ru
• Region-NetByNet-Modern - Фильмы - Kinfo.ru

Debugging DVM-programs . User's guide . ... 10.2 Obtaining debug versions of DVM-program for sequential and parallel execution . ... 10.4 Accumulation of DVM-program reference trace file . ... examining the execution trace when the program is executed in parallel mode (see section 5); . ... The command to start debug parallel version of DVM-program comparing execution results of executing the program on one processor, with previously accumulated reference trace. dvm red <DVM-program_name> . ...

Еще в разделе: (Показать все результаты (>177) - sp.cs.msu.ru/ )

• DVM debugger. Detailed design
• Prefictor of DVM-program performance. Preliminary design
• DVM debugger. Detailed design. Part 1

... In vitro, the protein S7 of Thermus thermophilus is able to form complexes with both the minimal 16S rRNA fragment and the intercistronic region of the str operon mRNA from E.coli (Kd = 1.4x10-7 M and 1.1x10-7 M respectively). ... The filter binding assay. ... The most striking result of our study is that thermophilic protein S7 binds strongly to the E.coli S12-S7 intercistronic region of str mRNA in vitro, inspite of the lack of the functionally analogous thermophilic extended region. ...

Еще в разделе: (Показать все результаты (>7) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/nar2004.pdf
• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf

... Intel Xeon DP 5060 (Dempsey, Netburst core) 3.2 GHz, 1067 MHz FSB, dual-processor (four CPU cores), Bensley platform, 4 GB DDR2 667 MHz RAM, 120 GB IDE HDD, Windows 2003 Enterprise Edition x64 . ... In addition, on Dempsey-based system, PC GAMESS used all eight logical processors for better performance. ... Single-point semi-direct two-state MCQDPT2 energy for medium-size system (retinal molecule, cc-pVDZ, 565 Cartesian basis functions, CAS(12,12)). ... Intel Clovertown (Quad-core Xeon DP X5365) vs....

Еще в разделе: (Показать все результаты (>108) - classic.chem.msu.su/ )

• Firefly/PC GAMESS standard MP4 benchmark results on modern hardware
• PC GAMESS/Firefly standard MCQDPT2 benchmark (using resolvent fitting code)
• The PC GAMESS SMP scaling results for model MP4-SDQ job

... 101, No. 4, 2005, pp. ... 128, No. 4, 2005, pp. ... NUCLEI, PARTICLES, FIELDS, GRAVITATION, AND ASTROPHYSICS Analysis of Small-Scale Wave Structures in the Saturnian A Ring Based on Data from the Cassini Interplanetary Spacecraft E. B. Postnikova and A. Yu. ... The method of analysis is based on the original algorithm of a continuous wavelet transform with a complex Morlet wavelet that reduces the integral transform to solving a Cauchy problem for a system of partial differential equations. ...

Еще в разделе: (Показать все результаты (>95) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/Inform_safety.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/JETP417.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/Loskutov_Kovaleva.pdf

... Наука >> Геология >> Общая и региональная геология | ... Написать комментарий . ... First International Conference on Sustainable Development in Karst Regions . ... FIRST INTERNATIONAL CONFERENCE ON SUSTAINABLE DEVELOPMENT IN KARST REGIONS будет проходить 24-27 августа 2001года. ...

Еще в разделе: (Показать все результаты (>482) - www.nature.web.ru/ )

• Получение пропептидов секреторных протеиназ бактерий методом гетерологичной

... line source . ... 6 def __init__ ( self , * args , ** kw ): . ... init__ ( self , * args , ** kw ) . ... 12 def attach ( self , widget ): . ... 15 widget [ command ] = lambda * args , ** kw : self . ... 17 def _command ( self , * args , ** kw ): . ... 24 def _set ( self , sender , * args , ** kw ): . ... 41 def tag_clear ( self , tag ): . ... 47 def insert ( self , * args , ** kw ): . ... insert ( self , * args , ** kw ) . ... 53 def _select ( self , ev ): . ... 79 names . ... 80 sequences . ...

Еще в разделе: (Показать все результаты (>11604) - kodomo.fbb.msu.ru/ )

• allpy: d0a4eb3fb962 allpy/markups.py
• allpy: 285d61f096f5 allpy/markups.py
• allpy: 0d1ba84a4080 allpy/markups.py

Summary Progress Report 2010 ­ 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...

Еще в разделе: (Показать все результаты (>885) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf
• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°
• п пµп·яѓп»яЊя‚п°я‚я‹ пїпѕпёяЃпєп° п¤п“пџ пњп“пе пёпј. пњ.п’.

The Department of Talented Youth Affairs and Professional Orientation . ... News . ... Older posts . Newer posts . Posted on 02.02.2016 by editor . ... Posted in News | Leave a comment . ... Deadline for applications: 02/29/2016 The purpose of the contest is to encourage talented Continue reading . ... Posted in News , Без рубрики | ... Posted on 28.12.2015 by editor . ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>109) - talant.msu.ru/ )

• Results of the 48th Mendeleev International Olympiad in Chemistry | The
• International Biological Universiade. Results | The Department of Talented
• editor | The Department of Talented Youth Affairs and Professional Orientation

BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...

Еще в разделе: (Показать все результаты (>2) - muscle.imec.msu.ru/ )