FINDING AREAS OF TYPICAL ARTIFACTS OF IMAGE ENHANCEMENT METHODS A.V. Nasonov, A.S. Krylov Laboratory of Mathematical Methods of Image Processing, Faculty of Computational Mathematics and Cybernetics, Lomonosov Moscow State University, 119991, Russia, Moscow, Leninskie gory, (495) 939-11-29, nasonov@cs.msu.ru, kryl@cs.msu.ru * The paper presents a new method to find areas related to typical artifacts of image enhancements methods. Two artifacts are analyzed: edge blur and overshooting effect. ...

Еще в разделе: (Показать все результаты (>489) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2011.ICIAR.Sorokin_Mizotin_Krylov.GaussLaguerreKeypoints.en.pdf
• http://imaging.cs.msu.ru/pub/2009.ICIP.Krylov_Lukin_Nasonov.IntEdgePres.en.pdf
• http://imaging.cs.msu.ru/pub/2012.PRIA.Nasonov_Krylov.EdgeMetrics.en.pdf

... Let the control system be given by the equation dx = X (x, u) = X, u U, dt where X is a vector field on the configuration space M , x M , u is the control parameter, U is the set of admissible values of u. With the vector field X we canonically associate a scalar-valued fiberwise linear function HX on the cotangent bundle T M , HX ( , u) = , X ( , u) , T M , u U, where : T M - M is the canonical pro jection. ...

Еще в разделе: (Показать все результаты (>21) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Pugh.pdf
• http://pont2008.cs.msu.ru/files/en/abstracts/Agrachev.pdf
• On mathematical creative work of L.S. Pontryagin (By D.V. Anosov) International

... 2, 1998 UNEXPECTED RECYCLIZATION OF PYRIDINIUM SALTS TO GIVE OXAZOLES E. V. Babaev and A. A. Tsisevich N-(Acylalkyl)-2-halopyridinium salts (I) are commonly used in the synthesis of azolopyridines with a bridging nitrogen atom. In particular, the formation of imidazo[l,2-a]pyridines and their N-alkyi- and N-aryl derivatives in the reaction of salts I with ammonia and primary amines [1, 2] or aromatic amines [1] is well known. ... Reactions of salts I with secondary amines have not been reported. ...

Еще в разделе: (Показать все результаты (>151) - www.chem.msu.ru/ )

• Intuitive Chemical Topology Concepts
• M.Overhand/ Membrane disrupting antibiotics
• Mathematical Chemistry

... High Brightness RTM . ... Fig.1a: 70-MeV pulsed race-track microtron . Many applications require compact, inexpensive and efficient source of electron beam in energy range 10-100 MeV. ... Beam is focused by accelerating structure, which acts as RF quadrupole singlet, quadrupole triplets (12) installed at the even orbits return path and by electromagnet quadrupole singlet (9) installed at common axis. ... Fig.1b: 70-MeV RTM Schematic . ... Energy gain: 4.8 MeV / orbit . Orbits: 14 . ...

Еще в разделе: (Показать все результаты (>4) - vserv.sinp.msu.ru/ )

ft ra D DAYS on DIFFRACTION 2012 1 Theory of selfrefraction effect of intensive fo cused acoustical b eams V.A. Gusev Lomonosov's Moscow State University, Physical Faculty, Department of Acoustics, Russia, 119991, Moscow, Leninskie gori; e-mail: vgusev@bk.ru The theory of selfrefraction of nonlinear acoustical beams is developed based on some exact and approximate analytical equations and solutions. ... What is the main factor limiting the pressure in the focus -- diffraction or selfrefraction? ...

Еще в разделе: (Показать все результаты (>43) - acoustics.phys.msu.ru/ )

Status of mTCA Slow Control development at CMS Petr Volkov1 D. V. Skobeltsyn Institute of Nuclear Physics, M. V. Lomonosov Moscow State University Leninskie Gory 1, 119991 Moscow, Russia The CMS experiment at the LHC at CERN has decided to upgrade their readout hardware at a large scale from VME to MicroTCA. ... As a typical use in the HEP environment the applying of SCADA system WinCC OA will be discussed for a Detector Control System (DCS) of several sub detectors. ...

Еще в разделе: (Показать все результаты (>197) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2013/qfthep_anom_tW.pdf
• http://qfthep.sinp.msu.ru/talks/qfthep2010_dubinin.pdf
• http://qfthep.sinp.msu.ru/talks/QFTHEP-2010_-_Sukachev.pdf

... What is the author's opinion on the problem? ... Organize the following parameters into 3 groups: content, organization, presentation (performance) · Body-language and eye contact · Fluency · Proper intonation and pronunciation · Relevant information and examples provided · Conclusion · Key concepts explained\defined · A range of complex grammatical structures and academic vocabulary · Key points emphasized · Introduction · Various linking devices, the transition from one point to the ...

Еще в разделе: (Показать все результаты (>23) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Sample_theses.pdf
• http://www.eng.math.msu.su/download/dictionary.pdf

... Conserved factor . Compensated factor . Cluster factor . ... Part of sequence . ... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . ... Alignment OR sequence (without name). ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>146) - www.genebee.msu.ru/ )

• Screening of pattern or alignment against PROTEIN databank
• GeneBee BLAST 2.2.22+ Services Help
• GeneBee BLAST 2.2.8 Services Help

... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>8) - margaret.imec.msu.ru/ )

• Large-Scale Load Stabilization
• On Square Parachute Differential Equations

ANISOTROPY EFFECTS INVESTIGATIONS BY RESISTIVITY METHOD IN SOME INHOMOGENEOUS MEDIA. ... Resistivity method is commonly used to investigate 1 - Linear array (AM, AMN) horizontally-layered media as sounding, and inhomogeneous media as 2 - Nonlinear array (DE or T) profiling. There is also the third fundamental model - anisotropic Model / =3, =90° halfspace. Anisotropy commonly is investigated with the circular resistivity measurements. ... The ellipses for two arrays. ... AMN arrays. ...

Еще в разделе: (Показать все результаты (>62) - geophys.geol.msu.ru/ )

• Anis. Page2

... Authors: A. M. Ghez, et al. arxiv:0808.2868 Измерение потока солнечных 8B нейтрино по данным 246 дней наблюдений на Борексино и обнаружение МСВ перехода вакуум-вещество (Measurement of the solar 8B neutrino flux with 246 live days of Borexino and observation of the MSW vacuum-matter transition) . Authors: The Borexino Collaboration . arxiv:0808.2292 Мультителескопный тайминг PSR J1518+4904 (Multi-telescope timing of PSR J1518+4904) . ... Authors: A.N. Belikov, S. Roser . ...

Еще в разделе: (Показать все результаты (>201) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/0310.html

... More Reports . ... Defence calls reflect levels of discomfort in the pallid gerbil ( Gerbillus perpallidus ) // Advances in Ethology. Contributions to the 5-th International Symposium on Physiology, Behaviour and Conservation of Wildlife. ... In contrast, winners never called. ... We assumed that a shortening of the distance between combatants reflected an increase of discomfort for the loser (caller), whereas an increased distance reflected decreased discomfort. ... Research * Student Reports . ...

Еще в разделе: (Показать все результаты (>53) - vertebrata.bio.msu.ru/ )

• Выступления студентов и аспирантов на конференциях

The quantitative probabilistic model of the solar energetic particle fluxes description . ... Notice : Undefined index : ion_spectra in / home / swx / public_html / models / database / modules / prog.php on line 152 Notice : Undefined index : MNX in / home / swx / public_html / models / database / modules / prog.php on line 153 Notice : Undefined index : NPB in / home / swx / public_html / models / database / modules / prog.php on ...

Еще в разделе: (Показать все результаты (>100) - swx.sinp.msu.ru/ )

• http://swx.sinp.msu.ru/models/database/modules/prog2.php
• http://swx.sinp.msu.ru/models/sw_forecast.php
• http://swx.sinp.msu.ru/models/get_charea.php

Anatoliy A. Polikarpov . ... Chronological Morphemic and Word-Formational Dictionary of Russian" contains Russian root, affixal, compound-affixal and other kinds of derivative words. ... Final goal of this activity is system investigation of some significant morphemic and word-formational system regularities of Russian language lexical stock. ... Some Main System-Quantitative Parameters of the DB "Chronological Morphemic and Word-Formational Dictionary of Russian" . ... Dictionary of Russian Language. ...

Еще в разделе: (Показать все результаты (>69) - old.philol.msu.ru/ )

• HumLang - Polikarpov A.A.- Chronological Morphemic and Word-Formational
• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics
• MSU-LGCLL:: Krylov J.K. - On the Nature of Koehler's Effect

Core information (Nucleus, Levels, Gamma transition, Decays, Data type) . ... any adopted (levels and gammas only) experimental . ... Query parameters: . Select for output . ... Levels (E, JPI, T1/2, etc.) ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . Relative photon intensity . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )

... To define in detail the molecular mechanism of NAD+-dependent formate dehydrogenase, the pH dependences of various kinetic and spectroscopic parameters have been studied: Vmax, Km (NAD+), Km (formate), inhibition constants for structural analogues of substrate (NO3-) and product (CNS-, CNO-, N3-), CD and fluorescence properties. The value of Vmax, rate-limiting hydride transfer, is nearly constant throughout the entire pH range of enzyme stability (6.0-11.2) but decreases below 6. ...

Еще в разделе: (Показать все результаты (>145) - www.enzyme.chem.msu.ru/ )

O.G. Koshelev . In the last years we have developed new methods of measurement of the photoelectric parameters of silicon wafers used for solar cell fabrication. ... One of the methods permits to determine the photoelectric parameters of wafer without conductive electrodes. ... The method can be easily automatized. The methods were tested on silicon solar cells irradiated by fast particles. ... A nondestructive method for measuring the photoelectric parameters of wafers with p-n-junctions. ...

Еще в разделе: (Показать все результаты (>71) - scon155.phys.msu.su/ )

• A new method for determining parameters of the potential well of off-center
• EXAFS studies of the local structure of In in PbTe, SnTe and GeTe

Euro-Asian Astronomical Society . The International Astronomy Olympiad . ... On the basis of the present Founding Statutes the Coordinating Council of the International Astronomy Olympiad elaborated and if necessary replenishes the "Acting Statutes/Regulations on International Astronomy Olympiad of School Children" which are approved at the meeting of authorized representatives from the founding organizations and participating states held every year during the Olympic period . ...

Еще в разделе: (Показать все результаты (>11) - www.issp.ac.ru/ )

... For the past years I have been working on the problem of synthesis of light curves of close binary systems, consisting of a normal star and a compact object (point object with fixed X-ray luminosity). ... Possible existence of a bright spot on the disk's lateral surface is taken into account. ... The last of then will be published in Gordon and Breach Publishers ( Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ... Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ...

Еще в разделе: (Показать все результаты (>12) - uranus.sai.msu.ru/ )

BNL PREPRINT BNL­QGS­98­0501 Study of Ї pp Baryon Exchange Processes V. L. Korotkikh 1;2 June 25, 1998 abstract The cross­section of the process Ї p + p ! ... ъ + + ъ \Gamma We repeated Barger and Cline's [3] calculation of reaction (3) and received the same 2 results at 10 GeV with their parameters: fi \Delta 8ъ = 0:10 GeV \Gamma1 ; s 0 = 2:85 GeV 2 ; ff \Delta (u) = 0:15 + 0:9 u: (5) The differential cross­section depends on these parameters as dЇoe du = 389:3 Їb ъ 2 s / fi \Delta 8ъ ! ...

Еще в разделе: (Показать все результаты (>50) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~vlk/report01_wl.ps