... Science Park . ... Agency for networking, information and communication technologies ( NETINFOKOM LLC) ank-nic@rambler.ru http://www.msunews.ru/ . ... Developing the infrastructure and information support needed for projects that provide an interdisciplinary exchange of science information and the potential for collective work on the base of network services and technologies. ... The company has a great deal of experience in the design, development and penetration of laboratory information systems. ...

Еще в разделе: (Показать все результаты (>9) - www.sciencepark.ru/ )

• MSU Science Park - About us

... To acquaint the reader with nonlinear dynamic systems; . ... The geology investigates of the Earth as a dynamic system. ... The analysis of behavior of systems with nonlinear interplay during time is a subject of this E-textbook. ... Key words: geological processes, dynamic system, nonlinear processes, chaotic dynamics, deterministic chaos, fractals. ... Chapter 1. ... For more information concerning the E-textbook "Dynamic processes in geology: Introduction to nonlinear systems" refer to the...

Еще в разделе: (Показать все результаты (>44) - dynamo.geol.msu.ru/ )

• Publications of V.Zakharov
• Professional experience of V.Zakharov
• Summaries of articles

You are here: Foswiki > System Web > ReferenceManual > UserDocumentationCategory > IncludeTopicsAndWebPages (23 Aug 2010, ProjectContributor ) E dit A ttach . The %INCLUDE{...}% macro embeds the content of the specified topic at the place where the INCLUDE is used. The whole content or only parts of of a page can be included. ... Syntax Example . ... Include a topic . ... INCLUDE{ "page" pattern="reg-exp" rev="2" warn="off" section="clients" PARAMETER1="value" PARAMETER2="Some value" }% . ...

Еще в разделе: (Показать все результаты (>2352) - wiki.cs.msu.ru/ )

• VarCachePlugin < System < Foswiki
• VarEXAMPLETAG < System < Foswiki
• HistoryPlugin < System < Foswiki

... Выпускники . ... The blood test is, when you think about it, a remarkable thing. ... Blood becomes data, and in these numbers lies knowledge about your current health, your risks for disease, and your potential response to treatment. ... The typical blood test report is an exercise in obfuscation, a document that needs to be translated by a lab technician or physician, and that's if you somehow manage to see a copy of your results. ... On the next few pages, Wired has given the lab report a makeover...

Еще в разделе: (Показать все результаты (>662) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Виза F-1 для студентов в США
• Клуб выпускников МГУ: Ученые научились определять биологический возраст по...
• Клуб выпускников МГУ: Обсуждение материала "The Blood Test Gets a Makeover"

... education . ... Composite materials . Materials for solar and fuel cells . ... Registration deadline is 30 April 2012. ... New deadline is 15 May 2012 . ... Registration fee should be paid before 10 June 2012. ... For information please contact Mrs. Olga Bogomolova: obogomol@gmail.com and Dr. Alexander Chertovich: chertov@polly.phys.msu.ru . ...

Еще в разделе: (Показать все результаты (>22) - nano.msu.ru/ )

• Registration for the International School ?Computer simulation of advanced

... Second set contains blast hits of the contig or the chromosome search against protein database, for example, Uniref90. ... Hit color corresponds to reading frame in the contig, color intensity is grteater than intensities of exons. ... Reading frame of five blast hits in the third exon of gene g4 are different than exon's reading frame . Blast hits in gene g3 located on reverse strand do not match reading frames of the 1st and 3rd exons and overlap 1-2 and 2-3 introns . ...

Еще в разделе: (Показать все результаты (>19) - mouse.belozersky.msu.ru/ )

• NPG-explorer
• Geometrical core

... References . ... References to books should include the author's name; year of publication; title; page numbers where appropriate; publisher; place of publication, in the order given in the example below. ... Ramirez, F. J., Marquez, R. A. C., and Mondaca, G.: 1991, The 1877 great tsunami and the rapid local warning network in the coast of Northern Chile - South America, In: Proc. International Conference of Australian Earthquake Engineering Society , Brisbane, Australia, 25-1. ... Information . ...

Еще в разделе: (Показать все результаты (>31) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Proceedings Download Page

... Newsgroups: sci.astro,sci.space.tech,sci.space.science,sci.space.shuttle,sci.answers,news.answers . Subject: Astro/Space Frequently Seen Acronyms . ... Acronym List for Space and Astronomy . ... Note that this is intended to be a reference for frequently seen acronyms, and is most emphatically not encyclopedic. ... Anglo-Australian Observatory . ... Astronomical Image Processing System . ... American National Standards Institute . ... Data Relay Satellite . ... List of Frequently Seen Acronyms (!) ...

Еще в разделе: (Показать все результаты (>86) - www.kosmofizika.ru/ )

... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... Samsung Electronics Co ., ... лидер в области высоких технологий приглашает аспирантов ведущих вузов страны (технических и физико-математических специальностей), завершающих обучение в аспирантуре в 2008/2009 году, на летнюю стажировку в исследовательских центрах компании в Южной Корее. ... Во время стажировки участник будет работать над представленным проектом, а эксперты компании будут оценивать его профессиональные знания. ...

Еще в разделе: (Показать все результаты (>135) - www.physcareer.ru/ )

• Исследовательская работа для инженеров-разработчиков / Вакансии / Physcareer.ru
• Quality Control Engineer / Tester (Student/Intern) / Вакансии / Physcareer.ru
• ЗАО КБ 'Ситибанк' ПРИГЛАШАЕТ НА РАБОТУ / Вакансии / Physcareer.ru

... Mathematical Treatment of Exhaust Systems with Acoustic Properties Using Mathlie I. Algorithms . ... The first part of the two talks is concerned with   algorithms applied to examples origin from an   exhaust system. ... The model equations are determined   by conservation of mass, momentum and energy. In addition there exists an equation of state   for the ideal gas system. ... Applying computer algebra to   these model equations, we demonstrate that   solutions can be derived. ...

Еще в разделе: (Показать все результаты (>274) - acs366.phys.msu.su/ )

• Modern Group Analysis (MOGRAN 9)
• Schedule : Modern Group Analysis (MOGRAN 9)
• Abstract (Invited)

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Align tool for DNA-protein complexes

... 1.2 Free-electron lasers . 1.3 Historical development of the XFEL . References . ... 2.3.5 Experience form the first user operation periods . ... 3 General layout of the XFEL Facility . ... 3.4 Beam distribution system . ... 4 XFEL ccelerator . ... 4.4.2 Space charge and coherent synchrotron radiation effects . ... 4.8.2 Layout of the XFEL synchronisation system. ... 5.1.1 Principles of XFEL operation . 5.1.2 Design criteria for the European XFEL . ... 6.1 Overview of the X-ray systems . ...

Еще в разделе: (Показать все результаты (>208) - nuclphys.sinp.msu.ru/ )

• Cryogenic testing stand for Nuclotron beam extraction elements.

... Labour recruiting policy and the Nobel Association of Oil Producers. A Set of Dbase Language Programs for Studying Social Dynamics . ... Our work was based on the personnel files of 2000 workers of the "Nobel Association of Oil Producers" (Garskova and Akhanchi 1993; see also Garskova and Akhanchi 1994). ... A set of dBase language programs . ... For this purpose a package of dBASE IV language programs has been created. ... The largest group of Nobel Brothers workers was Russians. ...

Еще в разделе: (Показать все результаты (>229) - hist.msu.ru/ )

• "Novaya i noveishaia istoria" Journal
• Internet-Heuristics for Historians: Course on Web Search and Data Retrieval.
• Volodin Andrei

Theoretical problems of electrical double layer structure on ideally polarizable electrodes and reversible adsorption of ions and neutral organic molecules on electrodes are considered, and also the specific features of kinetics of multistep electrochemical processes limited by mass transfer, electron transfer and chemical reaction. Special attention is paid to computer simulation of specific adsorption and coadsorption of ions and neutral organic molecules on the electrode surfaces. ...

Еще в разделе: (Показать все результаты (>85) - electr003.chem.msu.ru/ )

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . Институт проблем экологии и эволюции им. А.Н. Северцова РАН . Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: Gucci the The example, people really cons . ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . ...

Еще в разделе: (Показать все результаты (>8491) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: more design This article
• Экологический Форум - Фундаментальная Экология: a fim de passar um teste de
• Экологический Форум - Фундаментальная Экология: To be sure About those Windows