Russian] . The Geophysical department at MSU Geological faculty . The laboratory of near-surface electrical prospecting . ... TES technology for 2D resistivity sounding data processing, visualization and interpretation (unpublished article). ... Algorithms and computer programs for decision of forward and inverse problems of resistivity method have been developed in our laboratory. ... 119899, Russia, Moscow, Moscow State University, Geological Faculty, Department of Geophysics. ...

Еще в разделе: (Показать все результаты (>68) - www.geol.msu.ru/ )

• Software for resistivity and induced polarization
• Download Yuri Shvarov's files
• Faculty of Geology >> Departments

... Роджер Пэнг (љ Roger Peng) на своем youtube-канале выложил видео 4х недель своего курса ?Computing for Data Analysis? Week 1 : . ... Data Types . ... Reading/Writing Data: Part 1 . ... The ?str? function . ... Writing Functions . ... The mapply function in R . ... Using the apply function in R . ... Plotting (base graphics) . ... Plotting with lattice . ... IBM SPSS Statistics 20 и AMOS: профессиональный статистический анализ данных Самые важные научные исследования последнего десятилетия. ...

Еще в разделе: (Показать все результаты (>42) - tukachev.flogiston.ru/ )

. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>3) - apollo.sai.msu.ru/ )

• Dome Kislovodsk Database ::
• Astelco Kislovodsk Database ::

Russian] . The Geophysical department at MSU Geological faculty . The laboratory of near-surface electrical prospecting . ... TES technology for 2D resistivity sounding data processing, visualization and interpretation (unpublished article). ... Resistivity sounding ( in Russian ) . ... IPI2win & IPI_res3 (Windows) ver. 3.0.1a; 7-Jan-2003 . TRF_2D (Windows) [in English and in Russian] . ... 119899, Russia, Moscow, Moscow State University, Geological Faculty, Department of Geophysics. ...

Еще в разделе: (Показать все результаты (>41) - geophys.geol.msu.ru/ )

• Software for resistivity and induced polarization
• IPI2win - 1D interpretation of VES profile.

Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

• BIRDS SPECIES DATABASE of the Arctic Birds Breeding Conditions Survey

hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . ... Регистрация . ... Серия Blue Gene в мире . ... Доступ по SSH . ... Регламент доступа . ... С 2008 года на факультете ВМК МГУ имени М. В. Ломоносова работает суперкомпьютер IBM Blue Gene/P, который является одной из первых систем данной серии среди установленных в мире. Архитектура Blue Gene была предложена компанией IBM в рамках проекта по исследованию возможностей достижения новых рубежей в супервычислениях. ...

Еще в разделе: (Показать все результаты (>7) - hpc.cmc.msu.ru/ )

... DESCRIPTION General Catalog of Variable Stars (GCVS database) . ... Kholopov P.N., Samus N.N., Durlevich O.V., Kazarovets E.V., Kireeva N.N., Tsvetkova T.M., 1990, General Catalogue of Variable Stars, 4rd ed., vol.IV, Nauka, Moscow. Kholopov P.N., Samus N.N., Durlevich O.V., Kazarovets E.V., Kireeva N.N., Tsvetkova T.M., 1992, General Catalogue of Variable Stars, 4rd ed., vol.IV, Bull. ... Kazarovets E.V., Durlevich O.V. Editor-in-Chief Samus N.N., 1998, New Catalogue of Suspected Variable Stars. ...

Еще в разделе: (Показать все результаты (>58) - sai.msu.ru/ )

... Data . ... Solar energetic particles . ... Nucleon . ... Particle spectra at LEO . ... Overview ] [ Documentation ] [ SEP Events ] [ SEP Model ] . ... 1.2 High-energy heavy ions (Z = 6, 7, 8, 10, 12, 14, 16, and 26) by ACE spacecraft (SIS instrument) data are selected from: . ... The SEP events were selected by GOES-8 4th channel (15-40 MeV) data (see Fig.1). ... E тАУ ionтАЩs kinetic energy in MeV/nucl; Moc2 =938 MeV тАУ nucleon rest energy; †Я=v/c тАУ particleтАЩs relative velocity. ...

Еще в разделе: (Показать все результаты (>68) - smdc.sinp.msu.ru/ )

• Coronal holes database - Space monitoring data center
• Home - Space monitoring data center
• Scientific services - Space monitoring data center

... Первая десятка | ... Первая десятка "Русского переплета" Темы дня: . ... This document was generated using the LaTeX 2 HTML translator Version 96.1 (Feb 5, 1996) Copyright ї 1993, 1994, 1995, 1996, Nikos Drakos , Computer Based Learning Unit, University of Leeds. ... The translation was initiated by Lipunov V.M. on Tue Sep 23 14:45:21 MSD 1997 . Lipunov V.M. Tue Sep 23 14:45:21 MSD 1997 . ...

Еще в разделе: (Показать все результаты (>253) - www.pereplet.ru/ )

• Не работают cookies

... XML. ... Regular path queries with constraints. pages 122-133, 1997. ... Susan Davidson, Gerd Hillebrand, and Dan Suciu. A query language and optimization techniques for unstructured data. ... Peter Bimeman, Susan B. Davidson, Mary F. Fernandez, and Dan Suciu. ... Constraints for semistructured data and XML. ... Peter Buneman, Mary F. Fernandez, and Dan Suciu. UnQL: a query language and algebra for semistructured data based on structural recursion. ... A query language for XML. ...

Еще в разделе: (Показать все результаты (>81) - new.math.msu.su/ )

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>32) - electr003.chem.msu.ru/ )

Alexander S. Antonov . ... M.V.Lomonossov Moscow State University . ... June 4, 1999, Moscow State University . ... 1994-2000: programmer, Laboratory of Parallel Information Technologies, Research Computer Center, Moscow State University . ... A.S. Antonov, A.M. Teplov. ... Antonov A.S., Voevodin Vl.V., Sobolev S.I., Filamophitskiy M.P. Internet-Auditorium of Lomonosov Moscow State University // Abstracts of the All-Russian scientific conference "Scientific Services Internet" (Novorossiysk, 2000). ...

Еще в разделе: (Показать все результаты (>7) - asa.guru.ru/ )

The Department of Talented Youth Affairs and Professional Orientation . ... Older posts . Posted on 09.11.2015 by admin . ... The team competitions Continue reading . Posted in News , Без рубрики | Leave a comment . ... In the 2015/16 Continue reading . ... The festival is organized by the Department of Continue reading . ... Posted on 17.11.2014 by admin . ... Federal Agency for Youth Affairs ?Rosmolodezh?, ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>32) - talant.msu.ru/ )

• Moscow CTF School 2015 competitions in Information Security for schoolchildren

You are here: Iono Group / SAMNET / Magnetometers database . More information about each magnetometer is available by clicking on the station link. ... IMAGE . Alta, Norway . ... Andenes, Norway . ... SAMNET . ... BGS station, but archived at 1s resolution by SAMNET . ... Hankasalmi, Finland . ... IMAGE station, but archived at 1s resolution by SAMNET . ... 1s resolution data is available from the SAMNET data archive . ... This list can be filtered to show just SAMNET magnetometers . ...

Еще в разделе: (Показать все результаты (>28) - www.kosmofizika.ru/ )

• Index of /spravka/Magnetometers Database.files

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Студенты, обладающие визой F-1 в Соединенных Штатах Америки , теперь могут сделать изменения, объявленные в апреле, в программе Общего практического обучения. Срок программы обучения был продлен от 12 месяцев до 29 и теперь позволяет определенным студентам визы F-1 работать в США по профессиям, относящимся к области обучения студентов. ... Data Processing and Data Processing Technology/Technician. ... Architectural Engineering Technology/Technician. ... Civil Engineering Technology/Technician. ...

Еще в разделе: (Показать все результаты (>591) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Конференция "Вакансии"
• Клуб выпускников МГУ: 100 лучших компьютерных продуктов 2005 года
• Клуб выпускников МГУ: Конференция "Выпускники ВМиК"

.

Еще в разделе: (Показать все результаты (>41) - www.chemport.ru/ )

• Diy store chains of russia analytic database маркетинговое исследование рынка
• "Вакансия standards office manager" - вакансия в разделе "Работа для химиков"

Еще в разделе: (Показать все результаты (>10) - teconv.srcc.msu.ru/ )

The Database of Close Binary Systems . ... Team . Docs for editors . ... Anatol M. Cherepashchuk - principal investigator . Igor I. Antokhin - database design, programming and web interface . Editors: . ... Igor I. Antokhin . ... Anatol M. Cherepashchuk . ...

Еще в разделе: (Показать все результаты (>10) - uranus.sai.msu.ru/ )

• Stellar Astrophysics Department
• Linux on CLEVO 8750

Status of mTCA Slow Control development at CMS Petr Volkov Lomonosov Moscow State University Skobeltsyn Institute of Nuclear Physics, Russia 6/27/2015 P. Volkov SINP MSU 1 uTCA: Introduction MicroTCA® - open standard for fabric computer systems. MicroTCA systems are both physically small and non-expensive. ... Use PVSSII and the JCOP Framework to develop your control applications. These are the official CMS DCS developing tools. ... CMS_MTCA_HCALTR_CRATE1 CRATES.. ...

Еще в разделе: (Показать все результаты (>57) - qfthep.sinp.msu.ru/ )