Software on Data Processing . We Offer Statistical Software And . Software On Data Analysis And Processing. ... The package is intended for those, who doesn't have large experience in statistical analysis, but needs a quick and convenient data processing tool. ... Package provides full complex of registration and analysis methods, individual EKG monitor-analyzer, special tools for complete polygraph analysis. price: 700$ - 2200$. phone number (095) 437-3695, 155-1365 . ... InCo . ...

Еще в разделе: (Показать все результаты (>3) - statsoft.msu.ru/ )

... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...

Еще в разделе: (Показать все результаты (>8) - vernov-relec.sinp.msu.ru/ )

... Experimental and theoretical study of structure and evolution of hadrons under extreme conditions at high energies . ... Physics of the solar wind, interplanetary magnetic field and solar-terrestrial relations . ... Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . ... Research of fractal structure of aluminosilicates gels by a method of small angle scattering of neutrons and synchrotrons radiations . ...

Еще в разделе: (Показать все результаты (>49) - foroff.phys.msu.ru/ )

• Postdoctoral training (Neutronography)
• Postdoctoral training (Cosmic Rays and Physics of Space)

... Line: 1 to 1 . ... NOTE : The result from changes script and the topic WebChanges can be different, if the changes file is deleted from a web. ... Note: The manage script can only be called via http POST method for createweb renameweb , and deleteUserAccount . ... Note: The register script can only be called via http POST method, not GET. ... Note: The rename script can only be called via http POST method, not GET. ... Note: The save script can only be called via http POST method, not GET. ...

Еще в разделе: (Показать все результаты (>38964) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (17 vs. 18) - TWiki
• IncludeTopicsAndWebPages - TWiki - TWiki - (printable)

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...

Еще в разделе: (Показать все результаты (>5) - angel.cmc.msu.ru/ )

... MOLECULAR SPECTROSCOPY The Effect of Hydration of Ions of Inorganic Salts on the Shape of the Raman Stretching Band of Water S. A. Burikov, T. A. Dolenko, P. A. Velikotnyoe, A. V. Sugonyaev, and V. V. Fadeev Moscow State University, Moscow, 119992 Russia Received April 23, 2004 Abstract--The shape of the Raman stretching band of water molecules in aqueous solutions of electrolytes KBr, KCl, KI, NaCl, and NaI is studied. ... We used high purity grade and reagent grade salts. ...

Еще в разделе: (Показать все результаты (>30) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/Assets/Water/PatRec2007.pdf
• http://rswater.phys.msu.ru/en/articles/2015/PSS.pdf
• http://rswater.phys.msu.ru/Assets/Water/LasPhys2005.pdf

Special courses for the students of Physics Faculty, specialized at the Department. ... 32 hours, 6-th term . ... A review of characteristic ferroelectric and magnetic materials is given. ... The anomalies of physical properties in the phase transition in accordance with the crystal symmetry. ... Solid state physics . ... It is assumed that student will get knowledge about magnetic properties of such systems as molecular, clusters, nano-particles, surfaces, ultra thin films, mono- and multilayers. ...

Еще в разделе: (Показать все результаты (>27) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University
• Laboratory of Rare Earth Intermetallics

... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...

Еще в разделе: (Показать все результаты (>9) - lab106.imec.msu.ru/ )

A GENETIC ALGORHYTM FOR OPTIMIZING A NEURAL NETWORK CAPABLE TO LEARN FOR FOOD SEARCHING IN A RADIAL MAZE Budilova E.V., Chepurnova N.E., Chepurnov S.A, Teriokhin A.T. M.V.Lomonosov Moscow State University, Dept. of Biology. ... The upper platform has a hole in the middle and several radially directed tubular canals ("arms") each of which can contain a peace of food and has doors opening only in the centrifugal direction. ... The task of the animal is to visit only those arms which contain food. ...

Еще в разделе: (Показать все результаты (>49) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Longev_JEvolBio.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2002_Host_manip_IJP.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf

... High Brightness RTM . ... Fig.1a: 70-MeV pulsed race-track microtron . Many applications require compact, inexpensive and efficient source of electron beam in energy range 10-100 MeV. ... Beam is focused by accelerating structure, which acts as RF quadrupole singlet, quadrupole triplets (12) installed at the even orbits return path and by electromagnet quadrupole singlet (9) installed at common axis. ... Fig.1b: 70-MeV RTM Schematic . ... Energy gain: 4.8 MeV / orbit . Orbits: 14 . ...

Еще в разделе: (Показать все результаты (>5) - vserv.sinp.msu.ru/ )

Chlorophyll Fluorescence in vivo : A Theory (Part II). ... The model of carbon assimilation V c ( m M C m -3 s -1 ) by phytoplankton is based on light dependence of photosynthesis , which can be described by a coefficient of underwater radiation absorption by photosynthetic pigments of photosystem II in suspension of microalga a PSP (m -1 ) averaged over the spectral range of underwater radiation, where ... According this assumption the photosynthesis rate is equal to: . ...

Еще в разделе: (Показать все результаты (>21) - www.biophys.msu.ru/ )

• MEASURING THE PHYTOPLANKTON PHOTOSYNTHESIS RATE USING A PUMP-AND-PROBE
• Устинин Дмитрий Михайлович
• Chlorophyll Fluorescence in vivo: A Theory

You are here: Foswiki > System Web > ParentList (25 May 2012, ProjectContributor ) E dit A ttach . ... Default value . size . Size of the select box . ... The currently selected topic . ... STARTSECTION{ select }% select name='topicparent' size ='%IF{ defined size AND $ size then= %URLPARAM{ size default = % size % }% else= 10 }%' class='foswikiSelect' %TOPICLIST{ option $marker value='$name' $name / option web = %IF{ defined web AND $ web then= %URLPARAM{ web ...

Еще в разделе: (Показать все результаты (>5457) - wiki.cmc.msu.ru/ )

• VarBUTTON < System < Foswiki

... Preliminary Analysis of the Self Similarity of the Aftershocks of the Japanese Earthquake on March 11, 2011 V. S. Zakharov Faculty of Geology, Moscow State University, Moscow, 119991 Russia e mail: vszakharov@yandex.ru, zakharov@dynamo.geol.msu.ru Received October 11, 2011 Abstract--The quantitative parameters of the self similarity of the aftershocks of the Japanese earthquake on March 11, 2011 were obtained. ... Most aftershock hypocenters were located at a depth of 20­50 km. ...

Еще в разделе: (Показать все результаты (>25) - dynamo.geol.msu.ru/ )

• V.Zakharov's Ph.D. thesis
• Summaries of articles
• Доклады В.С.Захарова

... Лаборатория теоретической биофизики . ... ERG group members work with different types of molecules and consequently added new atomtypes into classical OPLS-AA distributed with GROMACS. ... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... All-atom automatic OPLS-AA topology generator . ... comcon1 in All-atom automatic OPLS-AA topology? . ... OPLS-AA? in All-atom automatic OPLS-AA topology? ... 2015 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>59) - erg.biophys.msu.ru/ )

• topology ERG Research Group: Лаборатория теоретической биофизики
• Quantum chemistry information page ERG Research Group: Лаборатория
• comcon1 ERG Research Group: Лаборатория теоретической биофизики

... We present some results of new calculations of D" ( t ) the second derivative of the Moon's elongation as a function of time. ... Let X be a set of all preserved recordings of observations of ancient Sun and Moon eclipses (see the list in [ 2 ], pp. 167 271): let A be a set of eclipses described in X (any eclipse a A may have some records corresponding to it and form X ( a )). ... The recount of dates t ( a 0 ), a 0 A ,( 700) < t ( a 0 ) < (+400), was first made by N. A. Morosov. ...

Еще в разделе: (Показать все результаты (>90) - hbar.phys.msu.ru/ )

• R.R.Newton, "Astronomical evidence..."
• newtrev2.htm
• Ответ Wally на книгу "Крах С14"

Development of new approaches to the analysis of ring shapes in organic molecules and the description of electronic distribution (atomic charges) and halogen bonding in the framework of forcefield model for rapid estimation of intra- and intermolecular interaction energies in molecular mechanics, molecular dynamics and docking methods . Forcefield is a model and a set of parameters for theoretical description of intra- and intermolecular interactions. ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>9) - qsar.chem.msu.ru/ )

You are here: Foswiki > System Web > JQueryPlugin > VarBUTTON (20 Sep 2010, ProjectContributor ) E dit A ttach . ... text", value="text" . text to be put on this button . ... icon . ... target . topic to open when clicking on the button . ... button: (default) normal click button, target specified in target or href parameter . ... submit: submits the form that contains the button . ... button . ... BUTTON{ "%MAKETEXT{"Cancel"}%" icon="cross" target="%WEB%.% ... System . ... Admin Maintenance . ...

Еще в разделе: (Показать все результаты (>1999) - wiki.cs.msu.ru/ )

• IncludeTopicsAndWebPages < System < Foswiki
• CompareRevisionsAddOn < System < Foswiki
• JQueryUIDialog < System < Foswiki

Peremennye Zvezdy ( Variable Stars ) 33 , No. ... From our comparison of magnitudes of bright stars in the Hipparcos catalogue and in the Tien-Shan catalogue of magnitudes, we compiled a list of stars that could be candidate photometric standards in the northern sky. The selected stars were tested for variability using the technique. ... Fig. ... It follows from Fig. 7 that if , then, according to the theory, we should expect the star to be variable. 54 stars are situated in the range. ... star . ...

Еще в разделе: (Показать все результаты (>10640) - www.astronet.ru/ )

• PG 1115+080: A Gravitational Cloverleaf
• Астронет > Полный список лекций, семинаров, конференций(Ближайшие семинары)
• Астронет > PG 1115+080: A Gravitational Cloverleaf

... The field of the fast first pulse is mainly localized within low refractive index layers, whereas the slow second pulse field is mostly in high refractive index layers. ... In the PC, each spectral component of a pulse incident at the Bragg angle with respect to the PC layers splits up into a coherent superposition of two transmitted and two diffracted diffractively reflected waves. ... The first pulse is formed by the waves E01 and Eh1, whereas the second one is formed by waves E02 and Eh2. ...

Еще в разделе: (Показать все результаты (>57) - genphys.phys.msu.su/ )

• http://genphys.phys.msu.su/rus/sci/optics/literature/15.pdf
• http://genphys.phys.msu.su/rus/sci/photonics/PDF/JETP56.pdf
• http://genphys.phys.msu.su/rus/sci/photonics/PDF/5.pdf