... MPI_Win_fenc win); A[rank] = 4; MPI_Win_fenc win); MPI_Put ( .. ... MPI-2 I/O: MPI - -, , - , MPI « » - , , . ... int MPI _File_close( MPI_File *fh) INOUT fh () , fh , fh, , MPI _FILE_CLOSE int MPI _File_set_view( MPI_File fh, MPI _ Offset disp, MPI_Datatype etype, MPI_Datatype filetype, char *datarep, MPI _Info info) I I I I I I N N N N N N OUT fh () disp () etype () filetype () datarep () info () int MPI _File_get_view( MPI_File fh, MPI _ Offset *disp, MPI_Datatype *etype, ...

Еще в разделе: (Показать все результаты (>3) - angel.cmc.msu.ru/ )

MEIS : ­ 2007 ­ 3/802 537.9 538.975 P.N.Chernykh, G.A Iferov., ... S. Abo, S. Ichihara, T. Lohner, F. Wakaya, T. Eimori, Y. Inoue, M. Takai, Nuclear Instruments and Methods in Physics Research B237 (2005) 72. ... D.P.Woodruff, Nuclear Instr. and Methods in Phys. Research B256 (2007) 293. ... T.Gustafsson, H.C. Lu, B. W. Busch, W. H. Schulte, E. Garfunkel, Nuclear Instr. and Methods in Physics Research B183 (2001) 146. ... L.R. Doolittle, Nuclear Instr. and Methods in Physics Research B9 (1985) 344. ...

Еще в разделе: (Показать все результаты (>113) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LAS/Nimb230_05_583ShulgaMashkova.pdf
• http://danp.sinp.msu.ru/LIIWM/Mashkova_NIMBInPress_ErosionC-Fiber.pdf
• http://danp.sinp.msu.ru/LINT/NIMB270_2012_P50.pdf

. Faculty of Mechanics and Mathematics, . M.V. Lomonosov Moscow State University . This site is created and supported by . the A.M. Liapunov French-Russian Institute . of Moscow State University .

Еще в разделе: (Показать все результаты (>52) - new.math.msu.su/ )

Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . Duration of training : 1 year . Supervisor of studies : A.M.Balagurov (professor, D.Sc., bala@nf.jinr.ru ) . ... In FLNP JINR there are unique opportunities for neutronography researches of nuclear and magnetic structure of crystals. ... Supervisor of studies: V.Yu.Pomjakushin (Ph. ... The near order and magnetic structure in amorphous magnetics. ...

Еще в разделе: (Показать все результаты (>35) - foroff.phys.msu.ru/ )

... L Сd , Pol a nd ABOUT EFFECTIVE MODES METHOD FOR DESCRIPTION OF INTERNAL DYNAMICS OF WEAKLY BOUND CLUSTERS Elena Belega, Evgeny Cheremukhin 1 , Dmitry Trubnikov Abstract: New approach to describe the internal dynamics of weakly bound clusters is presented. ... It is found that the number of active collective modes depends on the initial cluster excitation and that the internal energy is partitioned nonuniformly among the modes. ... Collective motion of oxygen atoms performs mostly in plane. ...

Еще в разделе: (Показать все результаты (>20) - beams.chem.msu.ru/ )

• http://beams.chem.msu.ru/doc/JCPSA613314144101_1.pdf
• http://beams.chem.msu.ru/sotrudniki/larin/CC_EF1f.doc
• http://beams.chem.msu.ru/sotrudniki/larin/IJQC70.pdf

Создание и оценка цифровых моделей рельефа высокой точности для урбанизированных территорий на основе цифровой картограф. продукции. Creating and evaluating high resolution DEM's for an urban environment from digital cartographic products / Carter J. R., Tripathy D. // 21 International Cartographic Conference "Cartographic Renaissance", Durban , 10-16 Aug., 2003. ... Durban, 2003, 10-16 Aug., ... С. 1851-1858. ...

Еще в разделе: (Показать все результаты (>23) - ecoinformatica.srcc.msu.ru/ )

International Journal for Parasitology 32 (2002) 817-824 www.parasitology-online.com Host manipulation by Ligula intestinalis: a cause or consequence of parasite aggregation? ... Here we consider whether these behavioural changes are important in shaping the distribution of parasite individuals across the fish population. ... Keywords: Ligula intestinalis; Roach; Macroparasitic aggregation; Host manipulation 1. ... Inference of parasite-induced host mortality from distributions of parasite loads. ...

Еще в разделе: (Показать все результаты (>39) - ecology.genebee.msu.ru/ )

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Еще в разделе: (Показать все результаты (>58) - fgp.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf

... Main page News People . ... Master net Homepage . ... SAI MSU 20-21 March 2014 . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Science committee: . ... E.S. Gorbovskoy (SAI MSU) . V.M. Lipunov ( chairperson, MSU, SAI) . G.V. Lipunova (SAI MSU) . ... M.V. Pruzhinskaya (SAI MSU) . A.M. Cherepashuk (MSU, SAI) . N.V. Tyurina (SAI MSU) . N.I. Shakura (SAI MSU) . ... The conference is organized by the Zel'dovich Moscow Astrophysics Seminar ( master.sai.m su.ru/osa/ ) . ...

Еще в разделе: (Показать все результаты (>23) - master.sai.msu.ru/ )

О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...

Еще в разделе: (Показать все результаты (>25) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2006/CD/Palymskiy2.doc

... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...

Еще в разделе: (Показать все результаты (>26) - ferro.phys.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ­ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf

... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...

Еще в разделе: (Показать все результаты (>73) - music.genebee.msu.ru/ )

... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...

Еще в разделе: (Показать все результаты (>53549) - distant.phys.msu.ru/ )

• Уведомление

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>12) - iconolat13.phys.msu.ru/ )

• Symposia
• Excursions

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

I NSTITUTE OF PHYSICS PUBLISHING PHYSICAL B IOLOGY Phys. Biol. 3 (2006) 121­129 doi:10.1088/1478-3975/3/2/004 Direct simulation of plastocyanin and cytochrome f interactions in solution I B Kovalenko1,AMAbaturova1, P A Gromov2,DMUstinin1, E A Grachev2, G Yu Riznichenko1 and ABRubin1 1 2 ... 2006 Online at stacks.iop.org/PhysBio/3/121 Abstract Most biological functions, including photosynthetic activity, are mediated by protein interactions ... We use this structure in our simulation. ...

Еще в разделе: (Показать все результаты (>36) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3329.pdf
• http://library.biophys.msu.ru/PDF/3336.pdf
• http://library.biophys.msu.ru/matorin/3385.pdf

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...

Еще в разделе: (Показать все результаты (>20) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%202.pdf
• http://antares.sinp.msu.ru/docs/2010_Amsterdam_Kulikovskiy.pdf
• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%203.pdf

... 2006 ARTICLE I. NAME AND PURPOSE Section 1. ... C. Secretary: The Secretary shall be the custodian of the records of the IHSS, maintain an up-to-date list of members in collaboration with the Vice President/President Elect and Chapter Coordinators, maintain minutes of all membership and Board meetings, conduct or supervise the correspondence of the IHSS, serve as editor of the IHSS Newsletter, and shall perform such other duties that may be delegated by the President, Vice President or the Board. ...

Еще в разделе: (Показать все результаты (>137) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2013/2013-Kostyukevich-etal.pdf
• http://www.mgumus.chem.msu.ru/publication/2012/2012-karpiouk-self.pdf
• http://www.mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf

... Science . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Home Science and education Scientific Laboratories Laboratory of nonlinear polarization optics . ... The mechanisms of evolution of polarization during radiation propagation in nonlinear media with nonlocality of optical response. ... As a result, a new field of science has originated, the nonlinear polarization optics, providing new insights into the interplay of polarization effects in classic nonlinear optical processes. ...

Еще в разделе: (Показать все результаты (>123) - ilc.phys.msu.ru/ )

• Публикация
• Publication