Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>20) - mph.cmc.msu.ru/ )

VIEWS Paul Murdin M T Wright Data, information and science I was one of almost half the IAU General Assembly that voted against the IAU resolution initiated by Elizabeth Griffin in Manchester in August 2000. ... The IUE archive, for example, delivers ultraviolet spectra into the hands of the community at the same rate that the satellite itself used to do, and papers frequently appear that are based on the archive. Other space missions like ISO and XMM have and are completing similar archives. ...

Еще в разделе: (Показать все результаты (>78) - hbar.phys.msu.ru/ )

• R.R.Newton, "Astronomical evidence..."
• The jump of the second derivative of the moon's elongation
• R. R. Newton, "Two uses of ancient astronomy"

with Materials Atoms Nuclear Instruments and Methods in Physics Research B xxx (2005) xxx­xxx www.elsevier.com/locate/nimb Cluster size dependence of sputtering yield by cluster ion beam irradiation T. Seki a a,b,* , T. Murase a, J. Matsuo a Quantum Science and Engineering Center, Kyoto University, Gokasyo, Uji ... These results suggested an empirical formula to calculate sputtering yield from the ion energy and the size distribution of the cluster. ... Fig. ...

Еще в разделе: (Показать все результаты (>78) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LIIWM/JPhysA39_2006_4775Pokhil.pdf
• http://danp.sinp.msu.ru/LIIWM/pre83_056707-Kho.pdf
• http://danp.sinp.msu.ru/LIIWM/JPhysB33_2000_5045Khodyrev.pdf

... B Dispatch: 30.1.04 Author Received: Journal: JEB CE: Kumar No. of pages: 12 PE: Sri doi:10.1111/j.1420-9101.2004.00705.x Human birthweight evolution across contrasting environments F. T H OMAS , * A . ... The model illustrates that optimal birthweight depends on which fitness-reducing risk locally predominates (somatic diseases, parasitic diseases or adverse environmental conditions). ... Growth in utero, blood pressure in childhood and adult life, and mortality from cardiovascular disease. ...

Еще в разделе: (Показать все результаты (>25) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Dimorph_HumBiol.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Crazy_Fred.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2003_Envir_human_EER.pdf

... However, derivation of its main equations from the free energy of a superconductor was only briefly described in the original paper [3], and some basic points of this procedure are still not completely understood. ... What is the sense of the free energy variation with respect to the vector potential of the magnetic field? ... Indeed, in practical calculations the Ginzburg­Landau equations are often used in combination with the Ginzburg­Landau free energy of the superconductor. ...

Еще в разделе: (Показать все результаты (>16) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/Masyukov-Dmitriev-11-JAP-InN.pdf
• http://lizard.phys.msu.su/home/science/Dmitriev-Ivanov-Xoxlov-11-JMathSci-Diffuser.pdf
• http://lizard.phys.msu.su/home/science/jap-06.pdf

О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...

Еще в разделе: (Показать все результаты (>3) - elast.math.msu.su/ )

... Carbon and Nitrogen As Resources Limiting the Growth of Mono- and Mixed Cultures of Pseudomonas aeruginosa Dissociants P. V. Fursovaa, E. S. Mil'kob, and A. P. Levichc c Department of Biophysics Department of Microbiology Department of General Ecology, Moscow State University, Moscow, 119991 Russia e-mail: fursova @biophys.msu.ru b a Received December 26, 2006 Abstract--New experiments for detection of resources limiting the ... 1997; Levich, 2000). ... 1) (Levich et al., ...

Еще в разделе: (Показать все результаты (>9) - dis.bio.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 ­ 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

... Keywords. conservative system, stability b oundary, singularity, multiple eigenvalue, p erturbation. ... Because of continuous dependence of eigenvalues on parameters a boundary of the stability domain is determined by the zero eigenvalue, while all other eigenvalues are positive. ... Using the results of Arnold [1] and a perturbation technique for eigenvalues [3, 9], a classification of singularities of stability boundaries in the generic case is obtained. ...

Еще в разделе: (Показать все результаты (>31) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/papers/marchesinmailybaev2008b.pdf
• http://mailybaev.imec.msu.ru/papers/KirillovEtAl2005.pdf
• http://mailybaev.imec.msu.ru/papers/Mailybaev2000.pdf

Documentation on Firefly v. 8.0.0 numerical gradient features . The numerical gradient code is activated as follows: . ... The primary purpose of this code is to allow computations normally requiring analytic energy gradients, to be performed using those QC methods for which analytic gradients are not yet programmed. ... The numerical gradients code is tightly integrated into Firefly and can be used anywhere where the analytical energy gradients are required by default. ... The default is 2. ...

Еще в разделе: (Показать все результаты (>43) - classic.chem.msu.su/ )

• Lesson 1: getting the most power of your multicore, SMP system or cluster with
• Firefly/PC GAMESS DOCUMENTATION - NEW MP2 GRADIENT CODE
• Real time data compression and decompression in the PC GAMESS/Firefly

МГУ имени М.В.Ломоносова Русская версия . ... Science calendar . ... Art Criticism and History . ... Economics . ... Chairman : Professor, Doctor of Technical Science Kravets Victor A. ( Deputy director of science) . ... Chairman: Professor, Doctor of Economics, academician, Full member of the Russian Academy of Sciences Nekipelov Alexander D. ( Director of Moscow School of Economics department of Moscow State University) . ... World economy (Professor, Doctor of Economics Glinkina Svetlana P.) . ...

Еще в разделе: (Показать все результаты (>8) - conf.msu.ru/ )

Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...

Еще в разделе: (Показать все результаты (>3) - cell.biophys.msu.ru/ )

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: €аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>11) - ecfs.msu.ru/ )

• Economic Department | ECFS
• Online Consultation on Network and Partnerships in the area of Food Security |
• Draft Plan of Action for Eurasian Subregional Partnership | ECFS

... Study of diaries and notebooks . The project is devoted to the research work of diary texts in Russian tradition and worldwide. The task of the work is to study, describe and create an independent corpus of computerized diary texts, i.e. diaries, note-books, autobiographies, memoirs, letters, which are called 'everyday literature' or 'ego-texts'. ... It is necessary to classify all types of Russian diary texts dating at least from the 17th century and up to now. ...

Еще в разделе: (Показать все результаты (>6) - lcl.srcc.msu.ru/ )

Nanoterrorism: New Responsibility for Our World and Future in the Global TechnoScience Vitaly G. Gorokhov Institute for Philosophy of the Russian Academy of Sciences, Institute of Technology Assessment and Systems Analysis of the Research Center Karlsruhe (Germany) Vitaly.Grorokhov@itas.fzk.de "Bioterrorism and chemical warfare are not unthinkable. ... 2] But these conditions do not else exist for the time being in nanoscience and nanotechnology. ...

Еще в разделе: (Показать все результаты (>9) - iisi.msu.ru/ )

THOMSON ELECTRON X-RAY SOURCE FOR MEDICAL APPLICATIONS E.G. BESSONOV1, R.M. FESHCHENKO1*, M.V. GORBUNKOV1, V.I. SHVEDUNOV2 and A.V. VINOGRADOV1 1 2 P.N. Lebedev Physical Institute, 119991 Russia, Moscow Leninskii Prospect 53 Nuclear Physics Institute of Moscow State University, 119899 Russia, Moscow, Vorobyevy Gory Abstract A source of medical x-rays based on a 50 Mev storage ring and a quasi-continues picosecond laser is considered. ... Then the storage ring emittance is 0.1 mmmrad. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• http://miles.sinp.msu.ru/files/Instr&Exp_Tech_Engl.pdf

JOURNAL OF APPLIED PHYSICS VOLUME 96, NUMBER 1 1 JULY 2004 Theoretical analysis of the synergism in the dielectric strength for SF6 у CF4 mixtures A. V. Larin ґ Laboratoire de Physico-Chimie Informatique, Facultes Universitaires Notre-Dame de la Paix, Rue de Bruxelles 61, B ... Calculated electron energy distribution function EEDF for the SF6 /CF4 mixture solid lines and a pure CF4 dashed lines or b pure SF6 dotted lines vs the electron energy under the same E / N values as given in Table IV. ...

Еще в разделе: (Показать все результаты (>17) - beams.chem.msu.ru/ )

• http://beams.chem.msu.ru/doc/JCPSA613314144101_1.pdf

... QED n = |G| . ... B] Ken Brown, Mathematics 4340, When are all groups of order n cyclic? ... http://olympiads.mccme.ru/lktg/2011/6/index.htm WHEN ANY GROUP OF N ELEMENTS IS CYCLIC? ... Thus |G| is divisible by m. QED A maximal subgroup of a group is a maximal by inclusion subgroup not coinciding with G and containing more than one element. ... 1) Any maximal subgroup F contains the center Z = Z (G) := {a G : g a = ag for any g G}, i.e., the set of elements commuting with each element of the group. ...

Еще в разделе: (Показать все результаты (>24) - halgebra.math.msu.su/ )

• staff:guterman:publ_engl.html | Кафедра высшей алгебры
• Зайцев Михаил Владимирович

... 7/8, 509-515 Article No. cb980291, available online at http://www.idealibrary.com on THE ROLE OF Ca IONS IN RESTORATION OF THE STRUCTURE OF INTERPHASE AND MITOTIC CHROMOSOMES IN PK LIVING CELLS AFTER HYPOTONIC STRESS A. A. AMCHENKOVA, I. M. BUZHURINA, L. A. GORGIDZE, I. V. KIREYEV, M. A. PANOV and V. JU. ... Similar structural complexes were revealed in mitotic chromosomes and nuclei of permeabilized cells at a gradual lowering of Ca2+ concentration in the incubation medium (Zatsepina et al., ...

Еще в разделе: (Показать все результаты (>28) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/Vorobjev03.pdf
• http://cellmotility.genebee.msu.ru/html/articles/alieva97.pdf
• http://cellmotility.genebee.msu.ru/html/articles/jcs.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• ConClus
• Nhunt: program for nucleic acid sequence similarity search