Mailing List . Discussion club . Unresolved problems in the Study of Nature and Evolution of Human Language . ... Our goal is to consider some interesting and still unresolved problems of general theory of Human Language. ... Regularities of Human Language Evolution?. ... Universal, typological and stylistic features of Human Language Evolution; . ... Large Explanatory Dictionary of Russian (SPb: Norint, 1998. - 1536p.): preliminary evoluation of the dictionary (Russian letter "X") . ...

Еще в разделе: (Показать все результаты (>81) - old.philol.msu.ru/ )

• MSU-LGCLL:: Papers submitted to QUALICO-94
• Dmitry V. Khmelev: List of Publications
• Д.В. Хмелев: Список публикаций

... Boris A. Grishanin is an Associate Professor in the Department of Physics, M.V.Lomonosov Moscow State University (MSU). He received his M.S. and Ph.D. degrees from MSU in 1963 and 1968, respectively (both in Physics). ... B. A.Grishanin's current research interests are in the field of quantum theory of open systems, laser physics, molecular dynamics of photoexcited molecules, problems of quantum information and quantum computing. ... Information theory . ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>75) - qilab.phys.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>75) - selena.sai.msu.ru/ )

• Санович А.Н.
• Anatoly N. Sanovich
• Vladislav V. Shevchenko

Актуальные проблемы современной териологии . С 18-22 ноября 2012 года состоялась всероссийская научная конференция "Актуальные проблемы современной териологии". ... Актуальные проблемы современной териологии: Тезисы докладов (18-22 сентября 2012 г. Новосибирск). ... Жигалин А.В., Хританков А.М. О сроках и особенностях размножения некоторых видов рукокрылых юга Сибири. ... Жигалин А.В. Состав фауны эктопаразитов рукокрылых некоторых районов Сибири. ... Крускоп С. В. О проблеме вида у рукокрылых. ...

Еще в разделе: (Показать все результаты (>1022) - zmmu.msu.ru/ )

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... During the round table, NAMMI and Lomonosov Moscow State University were represented by Sergey Smirnov, associate professor of the Faculty of Journalism of Lomonosov Moscow State University. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>34) - www.journ.msu.ru/ )

... Data . ... Solar energetic particles . ... Projects . ... Neutron flux variations (RU) . ... InterHelio-Zond . ... INTERHELIO-Zond PROJECT . ... INTERHELIO-Zond project is being developed within the framework of the Federal Space Program of the Russian Federation . It is aimed at the research of the Sun from close distances including inner heliosphere and solution of the problems of solar corona heating, acceleration of the solar wind, origin of the solar flares and coronal mass ejections. ...

Еще в разделе: (Показать все результаты (>10) - smdc.sinp.msu.ru/ )

Transhumus : Integrated software solution for interpretation of FT-ICR mass spectra of natural organic matter Anton Grigoryev1, 2, Alexey Kononikhin 1 2 2, 3 , Irina Perminova4, Eugene Nikolaev2, 3 ansgri@gmail.com Institute for Energy Problems of Chemical Physics, Moscow , Russia 3 Institute of Biochemical Physics, Moscow , Russia 4 Lomonosov Moscow State University, Moscow , Russia Natural organic matter ( ... However, there still are problems with interpretation of mass spectra of NOM. ...

Еще в разделе: (Показать все результаты (>145) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-kazachkov-optimization.pdf

A full system of equilibrium differential equations for the finite number of suspension lines (n = 28) of square parachute is derived. ... One can determine the shapes of inflated canopy radial cross-sections, stress distribution of radial ribbons on the canopy surface and fabric stress between them, drag coefficients for various line lengths and air-permeability by means of computer simulation. ... Initially, this problem was solved assuming D p = const over total canopy of square parachute. ...

Еще в разделе: (Показать все результаты (>7) - margaret.imec.msu.ru/ )

• Large-Scale Load Stabilization

XXIII ICTAM, 19ґ24 August 2012, Beijing, China CASES OF INTEGRABILITY IN DYNAMICS OF A RIGID BODY INTERACTING WITH A RESISTANT MEDIUM Maxim V. Shamolin Institute of Mechanics, Lomonosov Moscow State University, Moscow, 119899, Russian Federation Summary The author discovers new integrable cases of the rigid body motion in a resisting medium, including those in the classical problem of motion of a spherical pendulum placed in the over-running medium flow. ...

Еще в разделе: (Показать все результаты (>48) - shamolin2.imec.msu.ru/ )

• Mathematical Reviews

... With the usage of on-land and satellite altimetrical measurements data some gravity map were made, averaged on one degree trapeziums, in reductions Faja, Bouguer, Glenni, which were included in the geological-geophysical international atlases of Atlantic, Indian and Pacific oceans. ... Boldirev S.A., Gajnanov A.G., Stroev P.A. Dencital inhomogeneities in lithosphere and dynamics of development of the North-West part of the Pacific mobile belt. ... Moscow, Nedra edition, 1967. ...

Еще в разделе: (Показать все результаты (>95) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/engeol/eng/nauka-en.htm
• Download Yuri Shvarov's files
• Software for resistivity and induced polarization

SEISMIC DATA INTERPRETATIO N Graduate program "Applied Tectonics and Dynamic&Structural Geology" is intended for advanced studies in the classical chapters of Tectonics TECTONICS AND GEOLOGICAL and used to solve applied geological problems. All major areas, such as ANALYSIS FOR EXPLORATION Tectonics, Structural Geology, Geological Interpretation of the Geophysical Data and practical approaches for applied geological analysis, are covered by this graduate program. ...

Еще в разделе: (Показать все результаты (>21) - dynamo.geol.msu.ru/ )

• Textbooks - Dynamic Processes in Geology

Title Author Key words The Other as a margin and as a marginal experience in the process of sociocultural identity formation L.Ya. ... The author singles out four basic dimensions of identity phenomenon in the frame of the proposed approach. These dimensions are located in the range between oppositional notions: individual ґ collective, internal ґ external, content ґ boundary, static nature ґ dynamic nature. ... Also the functions of the Other in the process of identity formation are revealed. ...

Еще в разделе: (Показать все результаты (>79) - www.socio.msu.ru/ )

• Вестник МГУ

Attending conferences and workshops . ... Microphase separation in double comb copolymer melts Palyulin V.V., Potemkin I.I. 2. ... Spinodal of microphase separation in double comb copolymer melt" Palyulin V.V., Potemkin I.I. 6. 4-th Kargin s Conference "Polymer science for 21 st century" . ... The influence of the branch point distribution on the microphase separation transition in melts of double-grafted copolymers Palyulin V.V., Potemkin I.I. 8. 3 rd STIPOMAT Conference . ...

Еще в разделе: (Показать все результаты (>309) - polly.phys.msu.ru/ )

• Science
• Palyulin Research Page
• Polymers with Associating Groups (experiment + theory + computer experiment) -

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the  two-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>25) - erg.biophys.msu.ru/ )

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Source URL: http://ani.cs.msu.su/en/node . ... 8] http://ani.cmc.msu.ru/files/Расписание лекций консультаций 2015 (2).xls . ... 12] http://ani.cmc.msu.ru/files/Защ.дипл.работ 2015 (бПМиИ).doc . 13] http://ani.cmc.msu.ru/files/Защ.дипл.работ 2015 (спец.).doc . 14] http://ani.cmc.msu.ru/files/Гос.экз. 2015 (бПМиИ).doc . 15] http://ani.cmc.msu.ru/files/Гос.экз. 2015 (спец.).doc . ...

Еще в разделе: (Показать все результаты (>9) - ani.cs.msu.su/ )

• Courses
• The ASR Department at the CMC Faculty of Lomonosov MSU

Sequentia l C ontrol with Incomplete Informat io n: The Bayesian Approach to Many- Armed Bandit Problems, Academic Press, 1990, 266 p., augmented Englis h translat io n of: Moscow, Nauka, 1982, 256 p., ( I.M.Sonin) . ... New approach to the solution of the optimal stopping problem in a discrete time, Stochastics, special issue dedicated to Optimal Stopping and Applicatio ns, 2011 (in print) 9. ... 1997, . ... On a stochastic optimality of the feedback control in the LQG- problem. ...

Еще в разделе: (Показать все результаты (>22) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/sc_pub/presman_sc_pub_2011_en.pdf
• http://www.mse-msu.ru/Nekipeliv_31012011.pdf
• http://www.mse-msu.ru/sc_pub/ushkalova_sc_pub_2010_en.pdf

Evolution of the double neutron star merging rate and the cosmological origin of Gamma-ray burst sources " , Astroph.J., 1995, v.454, 593-596 (Lipunov, V.M. Postnov, K.A. and Prokhorov M.E.) . Evolution of Supernova?Explosion Rates in the? Universe (Jorgensen H., Lipunov.M., Panchenko I.E., Postnov K.A., Prokhorov M.E.) ApJ, 1997, v.486,p.110 . ... Formation of a Gravitationally Bound Object after Binary Neutron Star Merging and GRB phenomena " (G.V.Lipunova, V.M.Lipunov). ...

Еще в разделе: (Показать все результаты (>21) - observ.pereplet.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

M. A. Vorotyntsev 1 1,2,3, D. V. Konev3, M. Skompska 4 ICMUB-UMR 6302 CNRS, Universite de Bourgogne, Dijon, France 2 M. V. Lomonosov Moscow State University, Russia 3 Institute for Problems of Chemical Physics, Chernogolovka, Russia 4 University of Warsaw, Poland mivo2010@yandex.com, mv@elch.chem.msu.ru, mv@u-bourgogne.fr In situ measurements of specific conductivity of films on electrode surface Specific conductivity: function of potential Impedance problems: 1. ... Which thickness? ...

Еще в разделе: (Показать все результаты (>104) - electr003.chem.msu.ru/ )

• Laboratory of Electrical Double Layer and Electrode Kinetics
• Theory as a Lighthouse in the Electrochemical Ocean
• Laboratory of Electrochemical energetics

... find changesets by author, revision, files, or words in the commit message . ... author . ... 1 Source : allpy . ... 6 Build - Depends : @ cdbs @ . ... 8 Package : python - allpy . 9 Architecture : all . 10 Depends : python (>> 2.5 ) . 11 Description : Python library for working with alignments . ... 13 Package : geometrical - core . ... 15 Depends : python - allpy . 16 Description : Find geometrical core in a multiple alignment . ...

Еще в разделе: (Показать все результаты (>7506) - kodomo.fbb.msu.ru/ )

• allpy: 9adbec7c3366 lib/block.py
• allpy: 9adbec7c3366 lib/config.py
• allpy: e3f32195d901 allpy/config.py