... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

. Faculty of Mechanics and Mathematics, . M.V. Lomonosov Moscow State University . This site is created and supported by . the A.M. Liapunov French-Russian Institute . of Moscow State University .

Еще в разделе: (Показать все результаты (>28) - new.math.msu.su/ )

... 2 What is MATLAB ?? Basic Matrix Operations Script Files and M-files Some more Operations and Functions APPLICATIONS: Plotting functions .. ... Vectors are special forms of matrices and contain only one row OR one column. Scalars are matrices with only one row AND one column MATLAB Matrices 17 A matrix with only one row AND one column is a scalar. A scalar can be created in MATLAB as follows: » a_value=23 a_value = 23 MATLAB Matrices 18 A matrix with only one row is called a row vector. ...

Еще в разделе: (Показать все результаты (>8) - imaging.cs.msu.ru/ )

... IMPACT: New carbon-based materials with exceptional chemical and physical properties . ... AREA: Condensed Matter Physics, Physical Chemistry, Structure and Dynamics of Atomic-Molecular Systems, Engineering Sciences and Mechanical Engineering . ... Moscow State Uiversity . ... STRATEGY: Application of ab initio methods for simulation of forbidden reflections energy spectra taking into account thermal displacements of atoms and protons fluctuations. ... AREA: Condensed Matter Physics . ...

Еще в разделе: (Показать все результаты (>40) - hpc.msu.ru/ )

• Supercomputing Education Project | Moscow University Supercomputing Center
• SIGMA: Collective Bank of Tests on Parallel Computing | Moscow University
• Nationwide Supercomputing Education Project | Moscow University Supercomputing

... Site is discontinually updating by professional biologists and students of biology faculty of MSU. ... Journals began from 'P' . ... Packaging Technology and Science . Wiley Interscience ] . not defined] . ... International Palm Society ] . ... PAMM - Proceedings in Applied Mathematics and Mechanics . ... Proceedings of the Royal Society of London Series B - Bio... [ the Royal Society ] . ... Proceedings of the Society for Experimental Biology and M... ... JCatalog | Journal list . ...

Еще в разделе: (Показать все результаты (>181) - journals.genebee.msu.ru/ )

• JCatalog - Science Magazines Catalog

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>51) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => NSR Search Engine
• CDFE => Online Services => Nuclear Reaction Threshold and Energy Values

Программные средства построения интернет-атласов . ... В работе описывается разрабатываемая в НИВЦ МГУ технология и поддерживающие ее программные средства комплексного отображения разнородной пространственно распределенной информации, в том числе в среде Интернет. ... Описываемая технология состоит в подготовке на инструментальной машине файлов (HTML-страниц, файлов с программами управления данными и их визуальным представлением и файлов данных), представляющих собой Интернет публикацию. ...

Еще в разделе: (Показать все результаты (>16) - adept.srcc.msu.ru/ )

Создание и оценка цифровых моделей рельефа высокой точности для урбанизированных территорий на основе цифровой картограф. продукции. Creating and evaluating high resolution DEM's for an urban environment from digital cartographic products / Carter J. R., Tripathy D. // 21 International Cartographic Conference "Cartographic Renaissance", Durban , 10-16 Aug., 2003. ... Durban, 2003, 10-16 Aug., ... С. 1851-1858. ...

Еще в разделе: (Показать все результаты (>7) - ecoinformatica.srcc.msu.ru/ )

... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>11) - hcs.cmc.msu.ru/ )

• Master program "Enterprise Information Systems" | Магистерское и послевузовское

... О проекте . ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... The layout of beam-lines and experimental stations intended for the applications of the X-ray laser-electron generator to the investigation of the elemental composition, material structure and biological objects is discussed. ...

Еще в разделе: (Показать все результаты (>6) - miles.sinp.msu.ru/ )

... Main page News People . ... Master net Homepage . ... SAI MSU 20-21 March 2014 . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Science committee: . ... E.S. Gorbovskoy (SAI MSU) . V.M. Lipunov ( chairperson, MSU, SAI) . G.V. Lipunova (SAI MSU) . ... M.V. Pruzhinskaya (SAI MSU) . A.M. Cherepashuk (MSU, SAI) . N.V. Tyurina (SAI MSU) . N.I. Shakura (SAI MSU) . ... The conference is organized by the Zel'dovich Moscow Astrophysics Seminar ( master.sai.m su.ru/osa/ ) . ...

Еще в разделе: (Показать все результаты (>10) - master.sai.msu.ru/ )

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>29) - mailybaev.imec.msu.ru/ )

... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...

Еще в разделе: (Показать все результаты (>53549) - distant.phys.msu.ru/ )

• Уведомление

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>24) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...

Еще в разделе: (Показать все результаты (>73) - music.genebee.msu.ru/ )

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Description
• SAI Open Star Clusters (SAI OCL) Catalog

... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...

Еще в разделе: (Показать все результаты (>2) - do.chem.msu.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>6) - iconolat13.phys.msu.ru/ )

• Excursions
• Symposia

О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...

Еще в разделе: (Показать все результаты (>8) - hit-conf.imec.msu.ru/ )

... Scaliger sometimes forgot as anyone will when doing chronological computations whether he sought a current or a completed year, and therefore gave Julian dates that did not actually match the cyclical dates his computations had determined (e.g. eras 37,42, and 49). ... This table lists all the eras explicitly given as such by Scaliger, with their positions in the Julian Period and their dates in years BC or AD. ... To find a year in this era, subtract 296 from the date in the era of the Hegira. ...

Еще в разделе: (Показать все результаты (>83) - hbar.phys.msu.ru/ )