MEIS : ­ 2007 ­ 3/802 537.9 538.975 P.N.Chernykh, G.A Iferov., ... S. Abo, S. Ichihara, T. Lohner, F. Wakaya, T. Eimori, Y. Inoue, M. Takai, Nuclear Instruments and Methods in Physics Research B237 (2005) 72. ... D.P.Woodruff, Nuclear Instr. and Methods in Phys. Research B256 (2007) 293. ... T.Gustafsson, H.C. Lu, B. W. Busch, W. H. Schulte, E. Garfunkel, Nuclear Instr. and Methods in Physics Research B183 (2001) 146. ... L.R. Doolittle, Nuclear Instr. and Methods in Physics Research B9 (1985) 344. ...

Еще в разделе: (Показать все результаты (>91) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LINT/NIMB270_2012_P50.pdf
• http://danp.sinp.msu.ru/LAS/Nimb254_jan07_200Shulga.pdf
• http://danp.sinp.msu.ru/LIIWM/JPhysA39_2006_4775Pokhil.pdf

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>26) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...

Еще в разделе: (Показать все результаты (>76) - music.genebee.msu.ru/ )

• Untitled Normal Page
• H. Purcell: The Fairy Queen - Act IV

. ASA's collection of pictures useful for WWW-pages creation. ARROWS: 1-91 . BALLS: 1-145 . BUTTONS: 1-156 . ICONS: 1-263 . LINES: 1-174 . PATTERNS: 1-60 . VGIFS: 1-23 . You are since 9 July 1999 at this page. Go to Lab's HomePage . Go to ASA's HomePage .

Еще в разделе: (Показать все результаты (>10) - asa.guru.ru/ )

• People on #C4ACTbE right now

... Laboratory "Сryoelectronics" . Currently our group is working atљ experimental љstudying of nanoelectronic devices based on silicon, mostlyљsilicon nanowires and single-electron transistors. ... Suspended single-electron transistor made up from highly doped silicon on insulator (Laboratory of Cryoelectronics 2012)љ . ... E: This email address is being protected from spambots. You need JavaScript enabled to view it. P: +7 (495) 939-39-87 . ... 2016 Laboratory "Сryoelectronics" ...

Еще в разделе: (Показать все результаты (>12) - cryolab.phys.msu.ru/ )

• Molecular single-electronics
• Alexandr A. Parshintsev

. Veronika K. Laurinavichyute . /Lunina/ . Senior Scientific Researcher, PhD . CV . Selected Publications . News: . 12.08.2013. - Page updated 20.07.2013. - Project GRAVITSAPA started 01.07.2013. - Published: Practical exercises in physical chemistry. MGPU. Part 2. 2013 16-21.06.2013. - Workshop on composite materials, Harbin 10.04.2013. - On-line publication: Electrochimica Acta (2013), pp. 102-107 23.03.2012. - Website created! . nika@elch.chem.msu.ru . +7(495)939-1321 . Back

Еще в разделе: (Показать все результаты (>78) - electr003.chem.msu.ru/ )

Open Conference Systems . Conference Help . ... Username . Password . Remember me . ... Conference Content Search . All Authors Title Abstract Index terms Full Text . ... By Conference . By Author . By Title . ... For Authors . Home . ... Log In . Account . Search . Current Conferences . Home > Log In . ... Remember my username and password . ... Create an account with this site . Forgot your password? ...

Еще в разделе: (Показать все результаты (>49) - hea.phys.msu.su/ )

• Account

. Russian Version . Faculty of Computational Mathematics and Cybernetics . The Department of Operations Research . About Us . News . ORM2016: actual announcement and abstract templates . Archive of . Conferences ORM . Study . Undergraduates . Postgraduate education . Bachelor Program . Master Program . Faculty . Lecture . notes . Contacts . Graduates . New . publications . Create Date : 23.05.05 . The Department of Operations Research

Еще в разделе: (Показать все результаты (>21) - io.cmc.msu.ru/ )

• Кафедра Исследования Операций

... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . Final program Accommodation Program committee Organizing committee . ... V Moscow International Conference . on Operations Research, . ... Moscow, April 10-14, 2007 Final program . ...

Еще в разделе: (Показать все результаты (>10) - io.cs.msu.ru/ )

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... Please enter your username or email address. You will receive a link to create a new password via email. Username or E-mail: . ... Password . ... Lost Password . ...

Еще в разделе: (Показать все результаты (>45) - lomonosov.sinp.msu.ru/ )

• Scientific equipment | Университетский спутник "Ломоносов"
• Scientific goals | Университетский спутник "Ломоносов"
• DEPRON | Университетский спутник "Ломоносов"

... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>7) - margaret.imec.msu.ru/ )

• teachers

... about ERC . education . research . events . ... Being an effective way of acquiring knowledge, they also make a good addition to core lecture courses and involve students, postgraduates and scientists of other Russian higher education institutions and research centers in ERC activity in the initial stage. ... More information can be found at http://polly.phys.msu.ru/ru/unc/sconf.html . ... Conference on Development Prospects of Education and Research Centers in the Russian Federation . ...

Еще в разделе: (Показать все результаты (>17) - nano.msu.ru/ )

... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...

Еще в разделе: (Показать все результаты (>31) - nanofluidics.phys.msu.ru/ )

... Reports on progress and error are always recorded in the log file of the program. ... UT date of the measurement finish in YYYY-MM-DD format UT time of the measurement finish in hh:mm:ss format Average flux in A aperture Average flux in B aperture Average flux in C aperture Average flux in D aperture Normalized variance of flux in A aperture Normalized variance of flux in B aperture Normalized variance of flux in C aperture Normalized variance of flux in D ...

Еще в разделе: (Показать все результаты (>24) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/dimm_soft_description.pdf
• http://curl.sai.msu.ru/mass/download/doc/pmt_param_eng.pdf
• atmos 3.0 page

... Scaliger sometimes forgot as anyone will when doing chronological computations whether he sought a current or a completed year, and therefore gave Julian dates that did not actually match the cyclical dates his computations had determined (e.g. eras 37,42, and 49). ... This table lists all the eras explicitly given as such by Scaliger, with their positions in the Julian Period and their dates in years BC or AD. ... To find a year in this era, subtract 296 from the date in the era of the Hegira. ...

Еще в разделе: (Показать все результаты (>99) - hbar.phys.msu.ru/ )

• JulDate.htm

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Detoxifying Ability of Quinonoid-Enriched Humic Acids with Respect to Copper Vladimir A. Kholodov1, Natalia A. Kulikova2, Irina V. Perminova 1 2 2 Dokuchaev Soil Science Institute, Moscow, Russia, vkholod@mail.ru Lomonosov Moscow State University, Moscow, Russia Catechol, hydroquinone and p-benzoquinone enriched preparations of humic acid (HA) were obtained by modification of HA of brown coal. ... Detoxifying ability of humic preparations toward copper was estimated using seedling bioassay. ...

Еще в разделе: (Показать все результаты (>113) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf
• http://www.mgumus.chem.msu.ru/publication/2013/2013-Kostyukevich-etal.pdf
• http://www.mgumus.chem.msu.ru/ihss-14/docs/ihss%20travel%20support_russia_29_7.pdf

Electron Paramagnetic Resonance Plan (1) Principle of the EPR method (a) history of the EPR method discovery (b) mechanic and magnetic moments of electron (c) Zeeman's effect (d) resonance basic equation (2) EPR spectra characteristics (a) amplitude (b) line shape (c) line width (d) superfine structure (3) Scheme of an EPR radiospectrometer (4) EPR application in medical biological investigations (e) natural ... Among such radicals, nitroxyl radicals became the most popular. ...

Еще в разделе: (Показать все результаты (>27) - foroff.phys.msu.ru/ )

... MPI_Win_fenc win); A[rank] = 4; MPI_Win_fenc win); MPI_Put ( .. ... MPI-2 I/O: MPI - -, , - , MPI « » - , , . ... int MPI _File_close( MPI_File *fh) INOUT fh () , fh , fh, , MPI _FILE_CLOSE int MPI _File_set_view( MPI_File fh, MPI _ Offset disp, MPI_Datatype etype, MPI_Datatype filetype, char *datarep, MPI _Info info) I I I I I I N N N N N N OUT fh () disp () etype () filetype () datarep () info () int MPI _File_get_view( MPI_File fh, MPI _ Offset *disp, MPI_Datatype *etype, ...

Еще в разделе: (Показать все результаты (>4) - angel.cmc.msu.ru/ )

. Faculty of Mechanics and Mathematics, . M.V. Lomonosov Moscow State University . This site is created and supported by . the A.M. Liapunov French-Russian Institute . of Moscow State University .

Еще в разделе: (Показать все результаты (>61) - new.math.msu.su/ )