... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . Final program Accommodation Program committee Organizing committee . ... V Moscow International Conference . on Operations Research, . ... Moscow, April 10-14, 2007 Final program . ...

Еще в разделе: (Показать все результаты (>10) - io.cs.msu.ru/ )

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... Please enter your username or email address. You will receive a link to create a new password via email. Username or E-mail: . ... Password . ... Lost Password . ...

Еще в разделе: (Показать все результаты (>43) - lomonosov.sinp.msu.ru/ )

• Scientific equipment | Университетский спутник "Ломоносов"
• Scientific goals | Университетский спутник "Ломоносов"

... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>7) - margaret.imec.msu.ru/ )

• teachers

... about ERC . education . research . events . ... Being an effective way of acquiring knowledge, they also make a good addition to core lecture courses and involve students, postgraduates and scientists of other Russian higher education institutions and research centers in ERC activity in the initial stage. ... More information can be found at http://polly.phys.msu.ru/ru/unc/sconf.html . ... Conference on Development Prospects of Education and Research Centers in the Russian Federation . ...

Еще в разделе: (Показать все результаты (>17) - nano.msu.ru/ )

... News . ... Create new account (active tab) . ... Request new password . ... E-mail address * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. Group - None - 217 (2016 пЕпЎпЄ) 219 (2016 пЕпЎпЄ) 217 (2015 пЕпЎпЄ) 215 (2015 пЕпЎпЄ) 217 (2014 пЕпЎпЄ) 215 (2014 пЕпЎпЄ) 315 316 219 218 117 CAPTCHA . ...

Еще в разделе: (Показать все результаты (>201) - nanolab.phys.msu.ru/ )

• Contact vasyakov | Laboratory of Nanophotonics & Metamaterials
• Contact khokhlova | Laboratory of Nanophotonics & Metamaterials
• Contact khan | Laboratory of Nanophotonics & Metamaterials

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... MPI_Win_fenc win); A[rank] = 4; MPI_Win_fenc win); MPI_Put ( .. ... MPI-2 I/O: MPI - -, , - , MPI ? ? - , , . ... int MPI _File_close( MPI_File *fh) INOUT fh () , fh , fh, , MPI _FILE_CLOSE int MPI _File_set_view( MPI_File fh, MPI _ Offset disp, MPI_Datatype etype, MPI_Datatype filetype, char *datarep, MPI _Info info) I I I I I I N N N N N N OUT fh () disp () etype () filetype () datarep () info () int MPI _File_get_view( MPI_File fh, MPI _ Offset *disp, MPI_Datatype *etype, ...

Еще в разделе: (Показать все результаты (>4) - angel.cmc.msu.ru/ )

... It has been shown [1], that in some cases, in chaos set A the sub-set B can exist, in which the chaos behavior can be stabilized by external parametrical perturbations. ... As the first step I've found the A set (the set of chaotic behavior) and as a second step, by using different parameters combination (that can be consider as parameter perturbations of the system) I've found the B set (the set, where some stable cycles exists). ... For the f(x)=ax(1-x) map this is [3,8 4,0] interval. ...

Еще в разделе: (Показать все результаты (>66) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/Galss_ceramics.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/Letter_to_editor.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/TDB_Loskutov_Leonel.pdf

. Faculty of Mechanics and Mathematics, . M.V. Lomonosov Moscow State University . This site is created and supported by . the A.M. Liapunov French-Russian Institute . of Moscow State University .

Еще в разделе: (Показать все результаты (>36) - new.math.msu.su/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>9) - iconolat13.phys.msu.ru/ )

... Scaliger sometimes forgot as anyone will when doing chronological computations whether he sought a current or a completed year, and therefore gave Julian dates that did not actually match the cyclical dates his computations had determined (e.g. eras 37,42, and 49). ... This table lists all the eras explicitly given as such by Scaliger, with their positions in the Julian Period and their dates in years BC or AD. ... To find a year in this era, subtract 296 from the date in the era of the Hegira. ...

Еще в разделе: (Показать все результаты (>100) - hbar.phys.msu.ru/ )

. Home . Structure of Data . Description . Catalog . Publications . VO . ЮБ 2000 . 11:14:20.2 . ЮД 2000 . -57:33:04 . l . 290.172 . b . 2.895 . diameter . 14.0' . (m - M) 0 . 11.4 0.05 . distance . 1900 50 pc . E(B - V) . 0.08 0.01 . log(t) . 9.65 0.05 . (J, J-H) isochrone VOTable . 2MASS data VOTable . Developed by the Team . Send us your questions or feedback

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Czernik 23
• SAI OCL Catalog Czernik 21
• SAI OCL Catalog Berkeley 97

... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...

Еще в разделе: (Показать все результаты (>53549) - distant.phys.msu.ru/ )

• Уведомление

... Main page News People . ... Master net Homepage . ... SAI MSU 20-21 March 2014 . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Science committee: . ... E.S. Gorbovskoy (SAI MSU) . V.M. Lipunov ( chairperson, MSU, SAI) . G.V. Lipunova (SAI MSU) . ... M.V. Pruzhinskaya (SAI MSU) . A.M. Cherepashuk (MSU, SAI) . N.V. Tyurina (SAI MSU) . N.I. Shakura (SAI MSU) . ... The conference is organized by the Zel'dovich Moscow Astrophysics Seminar ( master.sai.m su.ru/osa/ ) . ...

Еще в разделе: (Показать все результаты (>26) - master.sai.msu.ru/ )

Программные средства построения интернет-атласов . ... В работе описывается разрабатываемая в НИВЦ МГУ технология и поддерживающие ее программные средства комплексного отображения разнородной пространственно распределенной информации, в том числе в среде Интернет. ... Описываемая технология состоит в подготовке на инструментальной машине файлов (HTML-страниц, файлов с программами управления данными и их визуальным представлением и файлов данных), представляющих собой Интернет публикацию. ...

Еще в разделе: (Показать все результаты (>22) - adept.srcc.msu.ru/ )

Создание и оценка цифровых моделей рельефа высокой точности для урбанизированных территорий на основе цифровой картограф. продукции. Creating and evaluating high resolution DEM's for an urban environment from digital cartographic products / Carter J. R., Tripathy D. // 21 International Cartographic Conference "Cartographic Renaissance", Durban , 10-16 Aug., 2003. ... Durban, 2003, 10-16 Aug., ... С. 1851-1858. ...

Еще в разделе: (Показать все результаты (>3) - ecoinformatica.srcc.msu.ru/ )

... О проекте . ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... The layout of beam-lines and experimental stations intended for the applications of the X-ray laser-electron generator to the investigation of the elemental composition, material structure and biological objects is discussed. ...

Еще в разделе: (Показать все результаты (>6) - miles.sinp.msu.ru/ )

Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenkoї, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia ї Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>110) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-kholodov-detoxifying.pdf
• http://www.mgumus.chem.msu.ru/publication/2008/2008-kulikova-detoxifying.pdf
• http://www.mgumus.chem.msu.ru/arw/database-sheet.doc

... All circuit parameters have been presented in a symbolic form. ... To use the program you will need a CIR file (PSpise, DesignLab file) of your circuit. CIR file examples have been enclosured: bpasside.cir, test1.cir, test2.cir, test3.cir, test4.cir, laksamp.cir, bridge.cir, uA741acf.cir, quartz.cir. ... Ideal operational amplifier (nullor) * Nname n1 n2 n3 n4 * * In the ideal op amp data, (n1,n2) represent output nodes, * (n3,n4) represent input nodes (noninverting, inverting). ...

Еще в разделе: (Показать все результаты (>11) - astrometric.sai.msu.ru/ )

• Symbolic matrix processor

... Alexey Garber Moscow State University April 17, 2010 A. Garb er (MSU) Quasicrystals April 17, 2010 1 / 33 ? This work is a joint work with Dirk Frettloh from Bielefeld University. A. Garb er (MSU) Quasicrystals April 17, 2010 2 / 33 Separated net Definition A subset A of metric space M is called separated net if for some constants r and R following condition holds: for every two points x1 , x2 A distance dM (x1 , x2 ) r and for every point y M dM (y , A) R . ...

Еще в разделе: (Показать все результаты (>293) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/TTC/slides/kamiyama.pdf
• Index of /~asmish/Lichnaja-2010/Version2010-11-20/UchProcess-2009