... V.M.Paskonov, S.V Rusakov, I.I.Chudov Difference Spline Scheme for Navier- Stokes Equations in Natural Variables. Com.Math. and Modeling,vol.8,No 2,pp.112-117, 1997 Z.M.Emel'yanova, V.M.Paskonov.Some Features of Viscous Gas Flow Injected into a Supersonic Stream from the Lateral Surface of the Cylinder. Com.Math. and Modeling,vol.8,No 2,pp.154-160, 1997. ... Modified Navier-Stokes Equations for Numerical Investigation Viscous Flows. Com.Math. and Modeling,vol.8,No 4,pp.487-495, 1997. ...

Еще в разделе: (Показать все результаты (>5) - mph.cmc.msu.ru/ )

• http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc

... Prof. I. V. Astashovas's general course for second year students . ... Questionary 2008-2009, PDF . ... Prof. Yu. ... Written test sample, PDF . ... Prof. I. N. Sergeev's general course for second year students . ... Prof. A. V. Borovskikh's general course for third year students (seminars) . ... Prof. G. A. Chechkin's general course for third year students . ... Prof. A. V. Filinovskii's general course for third year students . ... Prof. V. A. Kondratiev's general course for third year students . ...

Еще в разделе: (Показать все результаты (>31) - new.math.msu.su/ )

• Seminars of the department | Department: General Problems of Control. Faculty
• Geometric methods in optimal control theory | Department: General Problems of
• Control problems: theory and applications | Department: General Problems of

MGU Botanic Garden . ... MSU Botanical gardens branch 'Pharmaceutical garden' . ... Metro station Universitet , buses: 1, 113, 661, descend at the 'DK MSU' stop, buses 119, 67, 103, 130, 187, 260, trolleybus 34, descend at the stop 'Mendeelskaya st.'. 15-20 min from the metro station to the gates of the Garden. Metro st 'Kievskaya', bus 119, descend at the stop 'Mendeevskaya st', 30 min from the metro station to the gates of the Garden . ... MSU Botanical Garden: 'Pharmaceutical Garden' branch:: . ...

Еще в разделе: (Показать все результаты (>5) - botsad.msu.ru/ )

... The Department of Operations Research . ... Coordinators Contacts . ... on Operations Research, . ... Moscow, April 10-14, 2007 Coordinators . ... 1) New models and methods . Prof. V.V. Morozov . ... 3) Multiple objective decision making . ... Prof. I.G. Pospelov, Prof. A.A. Shananin . ... Prof. A.A. Belolipetckiy . ... 9) Game-theoretic models . ... Symposium A: Analysis of the markets and decision making in electric power industry . ... Symposium B: Models of political decision making. ...

Еще в разделе: (Показать все результаты (>4) - io.cs.msu.ru/ )

• Organizing Committee - ORM 2007
• Program committee - ORM 2007

... Moscow State University, Sternberg Astronomical Institute . ... Moscow State University, Sternberg Astronomical Institute, Cremian Laboratory . Dr. Vladimir Amirhanyan - Soft, Radioobservations, Interpretations . Sternberg Astronomical Institute . Aleksandr Belinskiy - mechanics, soft, observations, interpretation . ... Mikhaylo Kuznecov - mechanics, soft, observations, interpretation . ... Moscow State University, Physics Department . ... Gleb Antipov - observations, interpretation . ...

Еще в разделе: (Показать все результаты (>8) - observ.pereplet.ru/ )

... The Dynamic Characteristics of GPS Time Series and their Relation to the Seismotectonic Specific Features of a Region V. S. Zakharov Faculty of Geology, Moscow State University, Moscow, Russia e mail: vszakharov@yandex.ru Received October 23, 2012 Abstract--The noise component in the time series of Earth surface displacements that were obtained with the Global Positioning System (GPS) is analyzed for 19 points. ... These facts affect the values of the investigated fractal characteristics. ...

Еще в разделе: (Показать все результаты (>21) - dynamo.geol.msu.ru/ )

• Publications of V.Zakharov
• V.Zakharov's Ph.D. thesis
• Summaries of articles

... It was necessary to construct quite a different type of parachute to be light, compact, encased in a parapack and reliable. At first most parachute designers considered it to be hardly possible for a canopy to open in the air without the aid of some special devices, such as an umbrella spokes, compressed air or powder explosive charges. ... Later on a great number of different parachute systems were worked out and introduced by Russian parachute designers Nikolai Lobanov, Igor Glushkov and others. ...

Еще в разделе: (Показать все результаты (>7) - margaret.imec.msu.ru/ )

Faculty of Physics of Lomonosov Moscow State University . ... Department of Photonics and Microwave Physics is one of the largest departments of Faculty of Physics of Lomonosov Moscow State University . ... Our department holds annual conference on wave phenomena in nonhomogeneous media, physics and applications of microwaves in May in Moscow suburb. ... Physics of microwaves . ... Department of Photonics and Microwave Physics . Faculty of Physics . Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>3) - photonics.phys.msu.ru/ )

О КАФЕДРЕ . ... Трухин В. И. Жиляева В.А. Жиляева А. И. Петрунин Г. И. Список публикаций ·Список статей . ... Бобров А. В., Жиляева А. И. Минеральные ассоциации включений в гранатах из кимберлитовых трубок Мир и Сытыканская (Якутия) //Вестник НСО. ... A. Zhilyaeva, L. Leonyuk, G.-J. Babonas, G. Bocelli, S. Demishev, N. Leonyuk, V. Maltsev, A. Reza. ... Трухин В.И., Жиляева В.А., Жиляева А.И. Вязкая намагниченность (VRM) базальтов тройственного сочленения Буве (Южная Атлантика) // Физика Земли. ...

Еще в разделе: (Показать все результаты (>2) - geo.phys.msu.ru/ )

... Предыдущее сообщение: PARALLEL.RU - Новости, выпуск #263 [14/04/2009] . ... НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / news / + NVIDIA предоставляет пользователям OpenCL Driver. http ://www.nvidia.com/object/io_1240224603372.html + Psychsoftpc выпускает Psychlone Tesla Personal Supercomputer. http ://www.psychsoftpc.com/psychlone_tesla.htm + NSF финансирует участие 14 университетов в программе IBM/Google Cloud Computing University Initiative. http ://www.nsf.gov/ news...

Еще в разделе: (Показать все результаты (>16) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #261 [18/03/2009]
• PARALLEL.RU - Новости, выпуск #266 [27/05/2009]

... David Kirk/NVIDIA and Wen-mei W. Hwu , 2007-2012 ECE408/CS483, University of Illinois , Urbana-Champaign 14 CUDA Device Memory Management API functions Ї cudaMalloc() ґ Allocates object in the device global memory ґ Two parameters Ї Address of a pointer to the allocated object Ї Size of of allocated object in terms of bytes ( Device ) Grid Block (0, 0) Block (0, 1) Registers Registers Registers Registers Ї cudaFree() ґ Frees object from ...

Еще в разделе: (Показать все результаты (>5) - ccoe.msu.ru/ )

• http://ccoe.msu.ru/sites/default/files/nvidia_hpc_day.pdf
• http://ccoe.msu.ru/sites/default/files/RU_Apps_Catalog_Sep13_LR.pdf
• About the CCOE at Lomonosov Moscow State University | CUDA Center of Excellence

... WRF (Weather Research and Forecasting Model) [9]. ... NOAH LSM (National Centers for Environmental Prediction, Oregon State University, Air Force, Hydrology Lab-NWS Land Surface Model) [3]. ... WRF ґ (Urban Canopy Model, UCM) [6] (Building Environment Parameterization, BEP) [8]. ... C ґ ( HA = r Ї HR + rwЇHa ). , r ґ ( UCM NOAH LSM ? ? , , , (, .) H = A H ґ , LSM +A HA , (, H ґ ; A , , ); A ґ , (, , ); HLSM ґ , NOAH LSM; HA ґ , UCM. ... 48 1 29 2007 00 . ... WRF) : - NOAH; UCM - ; BEP - . ...

Еще в разделе: (Показать все результаты (>2) - atm563.phys.msu.ru/ )

... Study of the Russian " Silver Age " neology . ... Dictionaries of neologisms constitute an important part of lexicography. ... The peculiarity of our project is the full scope of text (at least published) considered and uniformity of description: dictionary entries of all the authors? neologisms have the same format (suggested for Khlebnikov?s neology). ... Khlebnikov's neology (N. N. Pertsova). In 1995 "The Dictionary of Khlebnikov's Neologisms" was published. ...

Еще в разделе: (Показать все результаты (>10) - lcl.srcc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• ConClus

Book Review Struct Multidisc Optim 28, 372 ґ 373 (2004) DOI 10.1007/s00158-004-0451-7 A.P. Seyranian and A.A. Mailybaev: "Multiparameter Stability Theory with Mechanical Applications" World Scientific Publishing Co. ... A remarkable feature of the book is the authors' presentation of a new multiparameter bifurcation theory of eigenvalues, which is a key point for the stability and instability studies. ... The material of the book is organized into 12 chapters. ...

Еще в разделе: (Показать все результаты (>24) - mailybaev.imec.msu.ru/ )

• Curriculum Vitae of Dr Alexei A
• Multiparameter Stability Theory with Mechanical Applications

... List of all selected researchers by country of host institution (in alphabetical order within each country group): http :// erc.europa.eu / pdf / ERC _StG2010Results_All_by_Country. pdf Lists of selected researchers by domain (in alphabetical order): Social Sciences and Humanities: http :// erc.europa.eu / pdf / ERC _StG2010Results_SH. pdf Life Sciences: http :// erc.europa.eu / pdf / ERC _StG2010Results_LS ... Calls for proposals: published annually in summer with deadlines in autumn. ...

Еще в разделе: (Показать все результаты (>19) - ideas.msu.ru/ )

M obile A stronomical Sy stem of TE lescope- R obots MASTER-II Kislovodsk Lomonosov Moscow State University, Sternberg Astronomical Institute , Moscow Union "Optic" , Kislovodsk Solar Station Latitude = 43 o  44'.767 N; Longitude = 42 o  31'.417 E; Altitude = 2067 m MASTER II (8 square degress) + MASTER VWF(Very Wide Field Cameras (FOV=800 square degrees, Time resolution up to 150 ms, with unfiltered m_lim=14m on 5 sec. exposure, and ~10.5m with 0.15 sec) . ... 11h 38m 38.0s , -09d 59m 59s) . ...