... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>25) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Align tool for DNA-protein complexes

SEISMIC DATA INTERPRETATIO N Graduate program "Applied Tectonics and Dynamic&Structural Geology" is intended for advanced studies in the classical chapters of Tectonics TECTONICS AND GEOLOGICAL and used to solve applied geological problems. All major areas, such as ANALYSIS FOR EXPLORATION Tectonics, Structural Geology, Geological Interpretation of the Geophysical Data and practical approaches for applied geological analysis, are covered by this graduate program. ...

Еще в разделе: (Показать все результаты (>34) - dynamo.geol.msu.ru/ )

Department of the History of Russian Social Movements and Political Parties . A great amount of attention in the faculty of history has always been given to the political history of Russian society, the history of social movements and the history of political parties. ... The basic directions of research work in the department are the history of social movements and political parties and political science. ...

Еще в разделе: (Показать все результаты (>37702) - hist.msu.ru/ )

• The Center for Theoretical Problems in the Historical Sciences
• Russia and Western Countries: Economic Relations Before World War I and the
• The Food Supply Problem and the Ways Overcoming it in Eastern Siberia in the

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>10) - math.phys.msu.ru/ )

Introduction QCD Sum rules Numerical analysis яonclusions ѕLEPTONIC CONSTANTS OF TENSOR MESONS IN QCD ї P. CHESNOKOV Physics Faculty of LOMONOSOV MOSCOW STATE UNIVERSITY General Nuclear Physics Department june 27, 2015 Lomonosov Moscow State University QFTHEP 2015 Contents 1 Introduction QCD Sum rules Numerical analysis яonclusions ... Lomonosov Moscow State University QFTHEP 2015 Introduction QCD Sum rules Numerical analysis яonclusions .. ...

Еще в разделе: (Показать все результаты (>159) - qfthep.sinp.msu.ru/ )

... 120 ­ 120 1 2 3 4 5 6 7 8 (.) 16 16 16 16 16 16 12 12 People and their characters Money. Spend it or save it Science Sports Family ties Creative talents Career perspectives Travelling 1-4 5-8 9-12 13-16 17-20 21-24 25-27 28-30 ( ). ... 200 . 110 . ... D «» «» «» «» 180-200 150-179 110-149 110 , . I. People and their characters - 5 15 - 5 - II. Money. ... Creative talents - - 20 VII. Career perspectives - - 5 5 10 VIII. Travelling - - 5 5 10 - - 40 40 80 200 ...

Еще в разделе: (Показать все результаты (>1347) - ffl.msu.ru/ )

• http://www.ffl.msu.ru/students/courses/fl-teaching/2-basova-general-english-2-lmkk-year.pdf
• About Us

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>57) - acoustics.phys.msu.ru/ )

... Khmelev D.V. Reconstruction of linear index expressions for reducing programs to a linear class//Zhurnal Vychislitel'noi Matematiki i Matematicheskoi Fiziki. ... Khmelev D.V. Limiting theorems for asymmetrical transportation networks//Fundamental and Applied mathematics, 2001, vol.7, no.4, pp. ... Khmelev D.V. Markov chains and classification of text passages. (in Russian) [Raspoznavaniye avtora teksta s ispol'zovaniyem cepei A.A. Markova] Vestnik MGU, Ser.9:Philologiya, No 2, 2000, pp. ...

Еще в разделе: (Показать все результаты (>63) - old.philol.msu.ru/ )

• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics
• Konferences
• Д.В. Хмелев: Список публикаций

... Reports on progress and error are always recorded in the log file of the program. ... UT date of the measurement finish in YYYY-MM-DD format UT time of the measurement finish in hh:mm:ss format Average flux in A aperture Average flux in B aperture Average flux in C aperture Average flux in D aperture Normalized variance of flux in A aperture Normalized variance of flux in B aperture Normalized variance of flux in C aperture Normalized variance of flux in D ...

Еще в разделе: (Показать все результаты (>28) - curl.sai.msu.ru/ )

• . The . MASS . Group .

... Robert Hermann Brookline, MA (Received November 22, 1999) der to illustrate the obvious progress, one can mention a variety of examples. ... In or- FYI Item "BMS Report on Institutes" As a member of the panel commissioned by the Board on Mathematical Sciences of the National Research Council, I write to correct several inaccuracies in the "For your information" note by Allyn Jackson entitled "BMS Report on Institutes" in the December 1999 issue of the Notices. ...

Еще в разделе: (Показать все результаты (>71) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/JETP417.pdf
• Activities

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Еще в разделе: (Показать все результаты (>1622) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf
• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf
• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

... 2012 Flow and Ridge phenomena from the CMS. ... 2012 "Эллиптический поток" для студентов. 2012 г. ( Семинар ЛАВ ОЭФВЭ, весенний семетр 2012 г) . 2012 "Подавление частиц и 'погашение' струй " для студентов. 2012 г. ( Семинар ЛАВ ОЭФВЭ, весенний семетр 2012 г) . 2012 Краткий обзор доклада Heinz et al., 2012 г. ( Семинар ЛАВ ОЭФВЭ, 2012 г) . ... Е.Kondratuyk, V.L. Korotkikh, I.P. Lokhtin, S.V.Petrushanko ( Семинар ЛАВ ОЭФВЭ, 29 ноября 2012 г) . ... V.L. Korotkikh ( Семинар ЛАВ ОЭФВЭ, 2014 г) . ...

Еще в разделе: (Показать все результаты (>51) - lav01.sinp.msu.ru/ )

• Vladimir L. Korotkikh
• Seminar of Strong Interaction Laboratory

Program: fuzznuc # Rundate: Sat 12 Dec 2015 12:42:19 # Commandline: fuzznuc # -sequence / data / npidb / pdb / pdb_new /DB/NucleicDB.fas # - pattern selH # -pmismatch 0 # -outfile / data / npidb / pdb / pdb_new /../ results / ef8ed45ae72b5d71419c1e1a05099874.fz.txt # Report_format: seqtable # Report_file: / data / npidb / pdb / pdb_new /../ results / ...

Еще в разделе: (Показать все результаты (>261) - monkey.belozersky.msu.ru/ )

• http://monkey.belozersky.msu.su/npidb/pdb/results/9355c1d0c5635cd099d9138d879a05d9.fz.txt
• http://monkey.belozersky.msu.su/npidb/pdb/results/8a8e606d11fb42e65e56eeb042f8c24d.fz.txt
• http://monkey.belozersky.msu.su/npidb/pdb/results/569185febb4476e558e30f0fb16c86d9.fz.txt

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>29) - mailybaev.imec.msu.ru/ )

... Dyakov Yu.T., Dolgova A.V. Vegetative Incompatiility in Plant Pathogenic Fungi. Moscow, Moscow Univ. 1995, 160 p. (in Russian). ... Moscow, ABF Publishing, 1997, 350 p. (in Russian). ... Dyakov Yu.T. Introduction to Algology and Mycology. ... Mycol. i. Fitopatrol. ... Vol. 116, p. 21-33. ... Mycol. i Fitopatol. ... Vol. ... Proceedings of the International Conference devoted to 80-th anniversary of mycology and algology department of Moscow State University and M.V. Gorlenko 90-th anniversary. ...

Еще в разделе: (Показать все результаты (>487) - herba.msu.ru/ )

• Systema Naturae
• The behavior of Nymphaea flowers
• Материалы А. Шипунова Советы по \R

... Инновационная . структура МГУ . ... Обучение инновационному менеджменту . ... Нормативно-правовая база инновационной . деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... Plan the Company's Future . ... Consider how much differentiation there should be in the company. ... Determine how formal the company will be structured? ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>39) - innovation.msu.ru/ )

... взаимодействие языка и культуры в контексте сравнительно-исторических исследований; . ... The Philology Faculty of Moscow State Lomonosov University will hold the VIII International Scientific Conference on Comparative-Historical Linguistics 'Modern methods of comparative historical research', from 25 to 27 September 2013, which is traditionally organized by the Department of General and Comparative-historical linguistics. ... History of Comparative Linguistics. ...

Еще в разделе: (Показать все результаты (>58) - genhis.philol.msu.ru/ )

Russian Journal of Electrochemistry, Vol. 37, No. 12, 2001, pp. ... CHRONICLE Yurii Aleksandrovich Chizmadzhev An outstanding Russian scientist, the corresponding member of the Russian Academy of Sciences Yurii Aleksandrovich Chizmadzhev marked his 70th birthday on December 15, 2001. ... In the Chizmadzhev laboratory, prime attention was devoted to an electroporation phenomenon, i.e. to the origination and development of micropores under the action of electric field. ...

Еще в разделе: (Показать все результаты (>69) - electr003.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/rus/spec/Vvedenie_v_spetsialnost_2/IUPAC_1982_nonaq_potential.pdf
• Inorganic Barrier Layers: Electron Transfer on Mercury Modified by Tungstate
• RADEN Data Bank

... info@ecfs.msu.ru . ... Home Resources Projects Draft Plan of Action for Eurasian Subregional.. ... On 7-9 September 2011, after long discussion between FAO and the European Commission, the launch of the Global Soil Partnership ( GSP ) took place at the FAO headquarters in Rome. ... The basic document indicates that Global Soil Partnership is based on regional soil partnerships. ... Assign the MSU Eurasian Center for Food Security as the Secretariat of the Eurasian sub-regional soil partnership. ...

Еще в разделе: (Показать все результаты (>35) - ecfs.msu.ru/ )

• CIMMYT Informa 1855 | ECFS
• Presentation of Global Nutrition Report | ECFS
• Online Consultation on Network and Partnerships in the area of Food Security |

... Parameters of February: Anomalies or normal Document on Russia 's environmental policy Governmental report On the state of the environment and on environmental protection in the Russian Federation in 2010 Technologies of environmental development A window into the world of the subglacial lake New specially protected natural territories in Russia New legal acts in the field of ... This is a major problem in the environmental field in Russia," noted Sergei Bobylev. ...

Еще в разделе: (Показать все результаты (>53) - eng.geogr.msu.ru/ )

• http://www.eng.geogr.msu.ru/science/newsletter/10_11_12.pdf
• http://www.eng.geogr.msu.ru/science/newsletter/02_13.pdf
• http://www.eng.geogr.msu.ru/science/newsletter/9_12.pdf