Status of mTCA Slow Control development at CMS Petr Volkov Lomonosov Moscow State University Skobeltsyn Institute of Nuclear Physics, Russia 6/27/2015 P. Volkov SINP MSU 1 uTCA: Introduction MicroTCA® - open standard for fabric computer systems. MicroTCA systems are both physically small and non-expensive. ... Use PVSSII and the JCOP Framework to develop your control applications. These are the official CMS DCS developing tools. ... CMS_MTCA_HCALTR_CRATE1 CRATES.. ...

Еще в разделе: (Показать все результаты (>155) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2013/POZDEEVAQFTHEP13.pdf
• http://qfthep.sinp.msu.ru/talks/QFTHEP-2010-PopovAV-1.pdf
• http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf

... The 56th ASMS Conference on Mass Spectrometry took place in Denver (CO, USA), June 1-5, 2008. ... International conference "Mass Spectrometry and Allied Topics" is an annual meeting of the American Society for Mass Spectrometry (ASMS). ... ASMS was founded in 1969 and, as of 2008, has approximately 7000 members, working on scientific reseach and development in mass spectrometry methods and instruments. ... The 56th ASMS Conference on Mass Spectrometry lasted five days. ... FT-ICR mass spectrometry ....

Еще в разделе: (Показать все результаты (>15) - ani.cmc.msu.ru/ )

• English edition of the ASR Department website
• Prof. Dmitry P. Kostomarov at the Differential Equations and Topology...
• Alexander Pozdneev at the SIAG/LA-SIMUMAT International Summer School on

... The 56th ASMS Conference on Mass Spectrometry took place in Denver (CO, USA), June 1-5, 2008. ... International conference "Mass Spectrometry and Allied Topics" is an annual meeting of the American Society for Mass Spectrometry (ASMS). ... ASMS was founded in 1969 and, as of 2008, has approximately 7000 members, working on scientific reseach and development in mass spectrometry methods and instruments. ... The 56th ASMS Conference on Mass Spectrometry lasted five days. ... FT-ICR mass spectrometry ....

Еще в разделе: (Показать все результаты (>7) - ani.cs.msu.su/ )

• English edition of the ASR Department website
• Prof. Dmitry P. Kostomarov at the Differential Equations and Topology...
• Alexander Pozdneev at the SIAG/LA-SIMUMAT International Summer School on

... SDPfox - the software package for the prediction of functional specificity groups and amino acid residues that determine the specificity using MPA. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...

Еще в разделе: (Показать все результаты (>138) - bioinf.fbb.msu.ru/ )

• RNA Alignment

... Research . ... Linguistic expeditions . ... Up to now the subjects to documentation were local dialects of Selkup, Ket, and Evenki. ... 1) creation and enlargement of multimedia computer archives of Selkup, Ket, and Evenki speech, which include sounding dictionaries and folklore texts and life-stories in audio, video, and graphic representation in local dialects of the surveyed villages; development of linguistic multimedia databases; . ... 8) research into the Selkup-Ket-Evenki language contacts; ....

Еще в разделе: (Показать все результаты (>24) - lcl.srcc.msu.ru/ )

... The given course consisting of lectures and seminars is aimed at teaching our students a whole range of measures, which allow quick and efficient faultfinding, functional testing, reliability testing of a device, find replacement for a faulty component at the modern technological level, fix a device, create a similar device even without the blueprints. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ...

Еще в разделе: (Показать все результаты (>26) - engineering.phys.msu.ru/ )

• Introduction to Linux
• FPGA Design
• Jumping Robot

... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>15) - heritage.sai.msu.ru/ )

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. ... April 11, 2013 - Bashneft Group in conjunction with JSFC "Sistema" opened the programme for the development of key Bashneft Group management - School of CEOs, "Capsule of security". ... At the end of his Welcoming Speech President of Bashneft Group stressed that this programme ? ... The School of CEOs ? ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• Admission committee | MSU Higher school of management and innovation
• School overview | MSU Higher school of management and innovation
• MSU Higher school of management and innovation |

... Dahl's texts and dictionaries in the Web (in Russian) . ... Employees of the Laboratory . ... About Laboratory . ... Anatoly Anatol'evich Polikarpov - a head of the laboratory - professor of Russian Language Department [ click here for personal information ] . ... About the laboratory . ... Development of techniques of gathering and analysis of mistakes of foreigners in Russian speech (a series of works of 1985-1991 under the leadership of A.A.Polikarpov with principal assictance by O.V.Kukushkina);...

Еще в разделе: (Показать все результаты (>59) - old.philol.msu.ru/ )

• Human Language - Язык Человека
• HumLang: Polikarpov A.A.- Menzerath's Law for Morphemic Structures of Words:A
• MSU-LGCLL:: DicTUM-1 - A System for Dictionary-Text Universal Manipulations and

... Guidelines for Paper Submission . ... The program committee will schedule both oral and poster sessions. The abstract and summary of both oral and poster papers are published in the same manner in the Conference Program and the Technical Digest on CD-ROM. ... Oral Sessions . ... Poster Sessions . ... For poster sessions, authors are provided with bulletin boards on which to display their papers, along with a sign indicating their paper numbers, and pushтАУpins or adhesive tape. ... Program . ...

Еще в разделе: (Показать все результаты (>22) - iconolat13.phys.msu.ru/ )

• Excursions
• Invited speakers

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Process of Forming a Company . ... Инновационная . структура МГУ . ... деятельности . ... Finance for Start-Up . ... Spin-off Company Development at the University of Alberta . ... Spin-off Company Development - Program Guidelines . ... However, these questions may help you determine if the time is right or wrong to proceed with a start-up company. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>23) - innovation.msu.ru/ )

... It has been shown [1], that in some cases, in chaos set A the sub-set B can exist, in which the chaos behavior can be stabilized by external parametrical perturbations. ... As the first step I've found the A set (the set of chaotic behavior) and as a second step, by using different parameters combination (that can be consider as parameter perturbations of the system) I've found the B set (the set, where some stable cycles exists). ... For the f(x)=ax(1-x) map this is [3,8 4,0] interval. ...

Еще в разделе: (Показать все результаты (>63) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/prokhorov/index.htm

... 2 · ­ , , · ­ · ­ , 03.12.2015 . ... 14 03.12.2015 · · · 03.12.2015 . ... Verifier Uni ve rsi ty of Te x as 2013 Anteater Uni ve rsi ty of Il l i noi s 2011 FlowChecker Uni ve rsi ty of North Carol i na 2010 VERMONT Network disjoint Port #02 Port #03 h2 h3 s1 Port #01 h1 Port #04 h4 main: disjoint() := Forall[x, out_x, y, out_y: !R(x, out_x) or !R(y, out_y) or x[p] == out_y[p] and out_x[p] == y[p] or x VERMONT proxy CLI Packets are delivered through the control plane We can block them! ...

Еще в разделе: (Показать все результаты (>10) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~bahmurov/course_realtime/papers/balashov_et_al_eucass2011_monitoring.doc

... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...

Еще в разделе: (Показать все результаты (>9) - psyberlink.flogiston.ru/ )

. ASA's collection of pictures useful for WWW-pages creation. ARROWS: 1-91 . BALLS: 1-145 . BUTTONS: 1-156 . ICONS: 1-263 . LINES: 1-174 . PATTERNS: 1-60 . VGIFS: 1-23 . You are since 9 July 1999 at this page. Go to Lab's HomePage . Go to ASA's HomePage .

Еще в разделе: (Показать все результаты (>12) - asa.guru.ru/ )

• People on #C4ACTbE right now

... Chair of Computer Methods of Physics . Department of Physics, M.V. Lomonosov Moscow State University . Create new account . ... Request new password . Username * . Enter your Chair of Computer Methods of Physics username. Password * . Enter the password that accompanies your username. ... Department of Physics M.V. Lomonosov Moscow State University , Chair of Computer Methods of Physics , 2014 . ... Let us know ! ...

Еще в разделе: (Показать все результаты (>3) - cmp.phys.msu.ru/ )

... Laboratory "Сryoelectronics" . Currently our group is working atљ experimental љstudying of nanoelectronic devices based on silicon, mostlyљsilicon nanowires and single-electron transistors. ... Suspended single-electron transistor made up from highly doped silicon on insulator (Laboratory of Cryoelectronics 2012)љ . ... E: This email address is being protected from spambots. You need JavaScript enabled to view it. P: +7 (495) 939-39-87 . ... 2016 Laboratory "Сryoelectronics" ...

Еще в разделе: (Показать все результаты (>15) - cryolab.phys.msu.ru/ )

• Molecular single-electronics
• Alexandr A. Parshintsev

. Veronika K. Laurinavichyute . /Lunina/ . Senior Scientific Researcher, PhD . CV . Selected Publications . News: . 12.08.2013. - Page updated 20.07.2013. - Project GRAVITSAPA started 01.07.2013. - Published: Practical exercises in physical chemistry. MGPU. Part 2. 2013 16-21.06.2013. - Workshop on composite materials, Harbin 10.04.2013. - On-line publication: Electrochimica Acta (2013), pp. 102-107 23.03.2012. - Website created! . nika@elch.chem.msu.ru . +7(495)939-1321 . Back

Еще в разделе: (Показать все результаты (>74) - electr003.chem.msu.ru/ )

• RADEN Data Bank

Open Conference Systems . Conference Help . ... Username . Password . Remember me . ... Conference Content Search . All Authors Title Abstract Index terms Full Text . ... By Conference . By Author . By Title . ... For Authors . Home . ... Log In . Account . Search . Current Conferences . Home > Log In . ... Remember my username and password . ... Create an account with this site . Forgot your password? ...

Еще в разделе: (Показать все результаты (>61) - hea.phys.msu.su/ )

• Account