О факультете . ... Социологические школы и олимпиады . ... Вестник МГУ . ... МГУ, д. 1. стр. ... English version . ... Programs for foreign students . ... Contacts Faculty of Sociology was founded on June 6, 1989. ... Hence the faculty offers the best educational programs to meet the needs of international students and requirements of contemporary sociology and employment standards in today?s dynamic and changing world. ... PhD programs The faculty provides studies for bachelor's degree in Sociology. ...

Еще в разделе: (Показать все результаты (>20) - www.socio.msu.ru/ )

... This course focuses on main characteristics of the ?life? of academic information (its development and diffusion), and on basic algorithms of data retrieval. ... This course consists of four interrelated areas: theoretical introduction (Internetics and information theory), and practical units including the three pillars of information retrieval services: factual, bibliographic and documentary search. ... Factual search. ... Internet-heuristics strategies: summarizing information retrieval skills . ...

Еще в разделе: (Показать все результаты (>155) - hist.msu.ru/ )

• Moscow State University. Faculty of History. About us.

Use of humates to remediate polluted environments: From theory to practice . ... Properties and functions of humic substances: potential implications for environmental protection . Chairperson: Prof. Chen . ... Coffee break . ... Perminova, I.V. Mediation effects of humic substances in polluted environments: implications for development of remediation technologies. ... Mediating effects of humic substances in polluted environments and their implications for humates-based remediation technologies . ...

Еще в разделе: (Показать все результаты (>142) - mgumus.chem.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>54) - www.chemport.ru/ )

• "Phd in computational chemistry (cyprus eu)" - вакансия в разделе "Работа для

Еще в разделе: (Показать все результаты (>2) - teconv.srcc.msu.ru/ )

... If you have already registered, please fill in you login and password in the form below main menu (leftmost column). ... If something goes wrong (for example, you've been registered by site andministrator and don't have password at all or you just forgot it), please contact site administration by E-mail dubna2007@biophys.msu.ru . ... If you are warned that you've already registered please contact site administration by E-mail dubna2007@biophys.msu.ru to get access to your Personal Office . ...

Еще в разделе: (Показать все результаты (>78) - www.msm.biophys.msu.ru/ )

Russian abstract] . Russian full text] . The classifications revealed by geometric morphometry and classical morphometry for Drosera rotundifolia , D. obovata , D. anglica and D. linearis were compared. ... the form of petiole middle part transverse section is the effective distinguishing character for the some different species and inter-species hybrids of Drosera ; . the consensus configurations are preferable for the geometric morphometry analysis of populations. ...

Еще в разделе: (Показать все результаты (>174) - herba.msu.ru/ )

Astronomy Picture of the Day . ... 14.06.1997 . ... Credit: F. Summers ( Princeton ), D. Cox, R. Patterson, E. Wesselak, and B. Sanders ( NCSA ), L. Carpenter ( Pixar ), GC3 , Cosmic Voyage , Smithsonian Explanation: What did our universe look like when it was young? ... Galaxies and long filaments formed - which are shown by the bright patches and streaks in the above frame . ... June 1997 . ... Building Galaxies in the Early Universe . ... Unexpected Galaxy String in the Early Universe . ...

Еще в разделе: (Показать все результаты (>5667) - www.astronet.ru/ )

• Journal "Peremennye Zvezdy"
• Астронет > The Early Universe

hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . ... Регистрация . ... Серия Blue Gene в мире . ... Доступ по SSH . ... Регламент доступа . ... С 2008 года на факультете ВМК МГУ имени М. В. Ломоносова работает суперкомпьютер IBM Blue Gene/P, который является одной из первых систем данной серии среди установленных в мире. Архитектура Blue Gene была предложена компанией IBM в рамках проекта по исследованию возможностей достижения новых рубежей в супервычислениях. ...

Еще в разделе: (Показать все результаты (>8) - hpc.cmc.msu.ru/ )

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>3) - www.eng.geogr.msu.ru/ )

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>48) - eng.geogr.msu.ru/ )

... Publications :: Differentiated Sills . ... Ariskin A.A., Barmina G.S., Frenkel M.Ya., Nielsen R.L. COMAGMAT: a Fortran program to model magma differentiation processes. ... Ariskin A.A., Barmina G.S. COMAGMAT: Development of a Magma Crystallization Model and Its Petrological Applications. ...

Еще в разделе: (Показать все результаты (>308) - geo.web.ru/ )

• Pletchov Pavel biography info
• COMAGMAT MODEL
• Результаты конкурса Schlumberger Scholarship Program - 2010 - Все о Геологии

Lomonosov project . News . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... July 8, 2012 . ... May 10, 2012 . The entrance control of cable system of scientific equipment ?Lomonosov? successfully completed. ... Input control tests of scientific equipment ?Lomonosov? devices is held in NIIEM. December 15, 2011 . Preparations for testing the dynamic module of scientific instruments for satellite ?Lomonosov? is finished. November 30, 2011 . ...

Еще в разделе: (Показать все результаты (>63) - lomonosov.sinp.msu.ru/ )

• Information unit (BI) | Университетский спутник "Ломоносов"
• Program of the experiment | Университетский спутник "Ломоносов"
• Automatic gaze stabilization corrector | Университетский спутник "Ломоносов"

... IPI-1D is a set of programs for processing and interpretation of VES data within the framework of horizontally layered models . ... Except programs already listed above, our specialists developed some programs for modeling, studying, visualization and interpretation of resistivity data in anisotropic media (anisotropic halfspace, horizontally layered media with anisotropic basement and vertical contact of two anisotropic media). ...

Еще в разделе: (Показать все результаты (>61) - geophys.geol.msu.ru/ )

• Software for resistivity and induced polarization
• Near-surface electrical prospecting laboratory at Moscow University

Geology at Moscow State University . ... In 1804 the Chair of Mineralogy and Rural Home Economics was established at the Department of Physical and Mathematical Sciences. ... Geological education at Moscow State University is an important link in the whole system of higher education of the Russian Federation, and being the major educational and scientific centre of the country the Geology Faculty coordinates the work of other academic universities in the field of geological education. ...

Еще в разделе: (Показать все результаты (>71) - www.geol.msu.ru/ )

• Software for resistivity and induced polarization
• Near-surface electrical prospecting laboratory at Moscow University
• Faculty of Geology >> Information for foreign students

... Co-Chairs: Andrius Baltuska (Technical Univ. of Vienna, Austria), Alexei Zheltikov (Lomonosov Moscow State Univ., ... Topics include, but are not limited to, pattern formation in optical systems, novel optical systems for nonlinear dynamics such as quantum dot lasers, hybrid devices, microlasers, fiber lasers; complex dynamics of nonlinear optical systems such as lasers or OPOs; instabilities in semiconductor lasers by injected signal, optical feedback, or multimode dynamics; ...

Еще в разделе: (Показать все результаты (>22) - iconolat13.phys.msu.ru/ )

• Program overview
• Foreword
• Guidelines

... E-MAIL ADDRESS: D.Khmelev@newton.cam.ac.uk . A new statistical method in the analysis of literary style for disputed authorship resolution is considered here. ... Consider a sequence of letter of text as a Markov chain. ... Suppose we take the logarithm of each probability, change a sign, and divide it by the length of control text; then each of the numbers obtained is called the relative empirical entropy . Relative empirical entropy is more convenient for computing than actual probabilities. ...

Еще в разделе: (Показать все результаты (>58) - old.philol.msu.ru/ )

• MSU-LGCLL:: Papers submitted to QUALICO-94
• MSU-LGCLL:: DicTUM-1 - A System for Dictionary-Text Universal Manipulations and

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>27) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Align tool for DNA-protein complexes

Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . ... ICES Journal of Marine Science: Journal du Conseil . ... Immunological Reviews . ... Industrial & Engineering Chemistry Research . ... International Journal of Impotence Research . ... International Journal of Management Reviews . ... International Journal of Public Opinion Research . ... International Journal of Urban and Regional Research . ... Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>9) - wwwlib.phys.msu.ru/ )

... Any type of file that is uploaded via browser and attached to a topic , where it can be viewed and downloaded. ... Web form at the bottom of a page that can be filled in with additional info and classification for the particular topic Details.. ... Preference - a customizable TWiki parameter; settings site-wide, by the web, by the topic on TWikiPreferences and WebPreferences pages, also on Plugins, user and regular topic pages. site - a TWiki installation consisting of one or more TWiki webs . ...

Еще в разделе: (Показать все результаты (>36926) - dualopt1.cmm.msu.ru/ )

• UserDocumentationCategory - TWiki - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki
• UserDocumentationCategory - TWiki - TWiki - (printable)