... public class Attribute . ... They have a name, type and an array of values. ... Attribute (java.lang.String name, double value) . ... If the value represents an array type, returns the Class object representing the component type of the array; otherwise returns null. int . ... Constructor Detail public Attribute (java.lang.String name, java.lang.Number value) . ... public Attribute (java.lang.String name, double value) . ... public Attribute (java.lang.String name, java.lang.Object theValue) . ...

Еще в разделе: (Показать все результаты (>98) - angel.cs.msu.su/ )

• : Class ScalarMultiArray
• : Class ProtoVariable
• : Class IndexIterator

. Next: So Which Entries are Up: Typically Used sendmail.m4 Parameters Previous: The Various Configuration Tables . The authors of sendmail+IDA provide the Sendmail.mc file which contains the true ``guts'' of what becomes the sendmail.cf file. Periodically, new versions are released to fix bugs or add functionality without requiring a full release and re-compilation of sendmail from sources. It is important not to edit this file. Andrew Anderson . Thu Mar 7 23:22:06 EST 1996

Еще в разделе: (Показать все результаты (>296) - itpm.msu.su/ )

• Typically Used sendmail.m4 Parameters
• ITPM MSU Web Page
• mod_isapi - Apache HTTP Server

... More Reports . ... Biphonation enhances a potential for individual recognition in the dhole ( Cuon alpinus ) // Advances in Ethology. ... Pack cohesion is very important for such collective hunters as the dholes, and is based, for the most part, on a repeated emission of especial calls. ... We have compared the impacts of the f and g components both independently and together into individual assignment of the biphonic calls in the dhole. ... Research * Student Reports . ...

Еще в разделе: (Показать все результаты (>83) - vertebrata.bio.msu.ru/ )

• Выступления студентов и аспирантов на конференциях

... Scientific Laboratories . ... Main Science and education Scientific Laboratories Laboratory of solid-state lasers and coherent spectroscopy . ... The first experiments in the laboratory of solid-state lasers and coherent spectroscopy were done in 1974-1975 years. ... In 1980, the laboratory began more complex experiments on the base of picosecond lasers, namely experiments realizing nonstationary picosecond CARS of molecular gases (CARS-coherent antiStokes Raman scattering). ...

Еще в разделе: (Показать все результаты (>194) - ofvp.phys.msu.ru/ )

ARRAYS FOR TENSOR MEASUREMENTS OF THE ELECTRIC FIELD Aleksandr Mousatov, Mexican Petroleum Institute, Mexico E-mail: amousat@imp.mx Evgueni Pervago, Mexican Petroleum Institute, Mexico E-mail: epervago@imp.mx Vladimir Shevnin, Mexican Petroleum Institute, Mexico, E-mail: vshevnin@imp.mx Abstract The study of resistivity anisotropy in heterogeneous media is a complex problem that needs developing the special field technology and interpretation technique. ... L is the array spacing. ...

Еще в разделе: (Показать все результаты (>70) - geophys.geol.msu.ru/ )

• Anis. Page2
• TES. Median algorithm

Lebedeva O. S. Tensor conjugate-gradient-type method for Rayleigh quotient minimization in block QTT format. Russian journal of numerical analysis and mathematical modelling, 26 (5), pp. 465-489, 2011. ... The tensor method has been implemented in the block QTT-format on the base of the block conjugate gradient method. ... Ключевые слова: tensor train format, quantics tensor train format, block tensor train format, low-parametric representations, block conjugate gradient method. ...

Еще в разделе: (Показать все результаты (>212) - srcc.msu.ru/ )

• Moss, D., Sokoloff, D., Lanza, A. F..Polar branches of stellar activity waves:
• Beck R., Frick P., Stepanov, R., Sokoloff D. Recognizing magnetic structures by
• Beck R., Frick P., Stepanov R., Sokoloff D. Recognizing magnetic structures by

... Новости . ... Музей . антропологии . ... Вестник МГУ Антропология . ... 26 ноября Музее антропологии открылась этнографическая выставка . ... Антропология" . ... Посмотреть фотографии . ... 2008-2010 Научно-исследовательский институт и Музей антропологии им.Д.Н.Анучина . Копирование материалов web-сайта только с разрешения администрации НИИ и Музея антропологии МГУ! ... При использовании материалов, размещенных на сайте НИИ и Музея антропологии МГУ, ссылка на источник обязательна! ...

Еще в разделе: (Показать все результаты (>31) - www.anthropos.msu.ru/ )

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>116) - electr003.chem.msu.ru/ )

• Victor A. Safonov: Selected Publications
• Elena V. Stenina: Selected Publications
• Evgeny V. Antipov:CV

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... The Albanian Agricultural Sector in transition" . ... Ministry of Agriculture and Food - Tirana Albania . ... Lithuanian Agricultural policy in Transition" . ... Lithuanian Institute of Agrarian Economics . ... Research Institute of Economics in Agriculture . ... Agricultural and Rural Development Policies between Market Orientation and Protectionism in CEECs" . ... Research Institute of Agricultural Economics (RIAE) . ... Institute of Agricultural and Food Economics - Warsaw - Poland . ...

Еще в разделе: (Показать все результаты (>170) - www.fadr.msu.ru/ )

• STUDYING POLICY DELIVERY SYSTEMS
• Contens
• Introduction

This module supports ISAPI Extensions within Apache for Windows. ... This module implements the Internet Server extension API. It allows Internet Server extensions ( e.g. ISAPI .dll modules) to be served by Apache for Windows, subject to the noted restrictions. ISAPI extension modules (.dll files) are written by third parties. ... Review the Additional Notes and the Programmer's Journal for additional details and clarification of the specific ISAPI support offered by mod_isapi. ...

Еще в разделе: (Показать все результаты (>65) - neptun.sai.msu.ru/ )

• Running a High-Performance Web Server for BSD
• Anatoly V. Zasov

... Institutes of Chernogolovka . The largest of all the scientific institutions of the center is the Institute of Chemical Physics in Chernogolovka , where fundamental problems of chemical physics are studied: kinetics and mechanisms of chemical and biological processes; processes of combustion, explosion, and polymerization; and mechanisms of elementary reactions involving high energy particles. ... Developments and Technologies . ...

Еще в разделе: (Показать все результаты (>24) - www.issp.ac.ru/ )

... L Сd , Pol a nd ABOUT EFFECTIVE MODES METHOD FOR DESCRIPTION OF INTERNAL DYNAMICS OF WEAKLY BOUND CLUSTERS Elena Belega, Evgeny Cheremukhin 1 , Dmitry Trubnikov Abstract: New approach to describe the internal dynamics of weakly bound clusters is presented. ... It is found that the number of active collective modes depends on the initial cluster excitation and that the internal energy is partitioned nonuniformly among the modes. ... Collective motion of oxygen atoms performs mostly in plane. ...

Еще в разделе: (Показать все результаты (>27) - beams.chem.msu.ru/ )

• http://beams.chem.msu.ru/doc/JCPSA613314144101_1.pdf
• http://beams.chem.msu.ru/doc/JAP2004_96_109.pdf
• http://beams.chem.msu.ru/sotrudniki/larin/IJQCh_04.pdf

... email: theory@socio.msu.ru) , , , , , , , , , , , social institution, sociologism, social control, structure, system, function, habitualization, costruction of social reality, duality of structure, structuration, organization - . The paper is dedicated to an analysis of major sociological conceptions of a social institution. ... The analysis reveals the analytical and practical importance of Weberian tradition, its role in contemporary sociological approaches to the problem of social institution. ...

Еще в разделе: (Показать все результаты (>94) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2010/3/19.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/4/05.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/4/10.pdf

A GENETIC ALGORHYTM FOR OPTIMIZING A NEURAL NETWORK CAPABLE TO LEARN FOR FOOD SEARCHING IN A RADIAL MAZE Budilova E.V., Chepurnova N.E., Chepurnov S.A, Teriokhin A.T. M.V.Lomonosov Moscow State University, Dept. of Biology. ... The upper platform has a hole in the middle and several radially directed tubular canals ("arms") each of which can contain a peace of food and has doors opening only in the centrifugal direction. ... The task of the animal is to visit only those arms which contain food. ...

Еще в разделе: (Показать все результаты (>53) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Longev_JEvolBio.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf

... A partial­wave analysis (PWA) 8--10 based on the extended maximum likelihood method has been used to study the spin­parity structure of the jъ \Gamma system. ... This does not preclude the possibility of some leakage of D+ wave to P+ wave being present in the data and distorting the results of the mass dependent fit 1 (MDF). ... In such a fit, the PWA is carried out so that all jъ \Gamma mass bins are fit simultaneously and are tied together with a mass­dependent function for each partial wave. ...

Еще в разделе: (Показать все результаты (>75) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~vlk/EyyubovaWPCF2014.pdf
• http://lav01.sinp.msu.ru/~igor/seminar/Hydjet_status_2013.pdf
• Vladimir L. Korotkikh

... О UNИX . ... ExportDump . ... Example with --page parameter using regular expression . Output . ... Known limitations "moin export dump" is an HTML export utility to create static HTML dumps of wiki content. ... The --page parameter is optional and will dump pages matching the pagename. ... With the parameter, the output is limited by ACL rules to pages that can be read by the username. ... Note the --page , --target-dir , and --username parameters must follow the export dump parameters. ...

Еще в разделе: (Показать все результаты (>201) - uneex.mithril.cs.msu.su/ )

• HelpOnEditLocks - UNИX
• Index of /static/KinoUserGuide/kino/help/en/media/edit
• Index of /static/KinoUserGuide/kino/help/en/media/edit/pointclick

... О UNИX . ... ExportDump . ... Example with --page parameter using regular expression . Output . ... Known limitations "moin export dump" is an HTML export utility to create static HTML dumps of wiki content. ... The --page parameter is optional and will dump pages matching the pagename. ... With the parameter, the output is limited by ACL rules to pages that can be read by the username. ... Note the --page , --target-dir , and --username parameters must follow the export dump parameters. ...

Еще в разделе: (Показать все результаты (>406) - uneex.lorien.cs.msu.su/ )

• The Edit Menu
• Edit Menu
• Chapterљ7.љHow to Edit with Kino

... Master . Master net Homepage . ... MASTER . ... About Space Monitoring Laboratory, scientific directions, instruments, contacts . ... Russian Robotic Net MASTER of Lomonosov Moscow State University discovered the Most Powerfull Object in the Universe . ... Using the 40-cm (16-inch) f/2.5 reflectors equipped with 16-Mpix CCD cameras they have found the brightening of the poorly studied flat spectrum radio quasar CGRaBS J0809+5341 = FIRST J080941.7+534125 with the known redshift z=2.133. ...

Еще в разделе: (Показать все результаты (>309) - master.sai.msu.ru/ )

... PhD student needed in the Institute of Physical Chemistry in Warsaw, Poland for a study involving mostly calculations and NMR measurements of strained hydrocarbons with unusual spatial structure. ... As can be seen in the webpage, the group is also involved in studies in supramolecular chemistry and, if interested, the student could also take part in this research. ... The entrance exam is based on "Physical Chemistry" by Atkins. ...

Еще в разделе: (Показать все результаты (>92) - www.chemport.ru/ )

• Tyco amp molex corporations electronic components distributors готовые бизнес