... Excitation of X-ray fluorescence of massive samples by bremsstrahlung: analytical possibilities of monochromatic model . Abstract The algorithm of calculation of equivalent analytical wavelength of bremsstrahlung spectrum during excitation of X-ray fluorescence of multicomponent subjects with arbitrary thickness was proposed. ... Moscow University Chemistry Bulletin . 2008, Vol. ... Copyright (C) Chemistry Dept., ... Copyright (C) Chemisty Department of Moscow State University . ...
... Форумы > Разное > Тема . Автор темы Clever . Форумы Список тем Новая тема . 02.04.2005 12:48 . Clever . ... А что это означает? ... Следующая тема Предыдущая тема . ... Извините, только зарегистрированные пользователи могут публиковать сообщения в этом форуме. ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Kalioujnaia I. , Carsjens G.J. , Vorobyova T. , Kalioujnaia N. в сборнике Sustainable development of territories: GIS theory and practice. ... 1995 Preliminary Methodological Conclusions Related to the Creation of an Environmental Arctic Database . ...
Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...
... IPI program works with group of sounding curves (from 1 to 100) in one data file. ... If Type of Array is =+3 or +4, then: 7 line : Name of VES (from 1 to 8 symbols) 8 line : number of distances for this VES . 9 line : dV values (in mV or V) 10 line : I values (in mA or A) Examples of *.dtg file : Example 1 for stabilized current AMN array Bilibino-90, VES from 24.5 to 43.0. 1 2 lines - description of data profile 4 1 0 17 1 -3 S { VES number , KeyIP, ?ax.nAB, ...
... Molecular Mechanics Calculations of beta-Diketonate, Aqua, And Aqua-beta-Diketonate Complexes of Lanthanide Ions Using Gillespie-Kepert Model . ... Abstract - A version of molecular mechanics based on the Gillespie-Kepert model of coordination bonds "repulsion" is applied to lanthanide complexes. ... For the aqua complexes, typical root-mean-square deviation (calculated vs. ...
... On-line консультант . ... Анонсы Online семинары . ... Семинар состоится 22.07.2010 в 16.00 . ... Семинар состоится 12.08 в 16.00 . ... Получить подробную информацию о семинарах и зарегистрироваться Вы можете на сайте . ... Copyright ВМиК МГУ , 2008 . ...
Doxyfile 1.4.6-NO # This file describes the settings to be used by the documentation system # doxygen (www.doxygen.org) for a project # # All text after a hash (#) is considered a comment and will be ignored # The format is: # TAG = value [value, .. ... USE_WINDOWS_ENCODING = YES # If the BRIEF_MEMBER_DESC tag is set to YES (the default) Doxygen will # include brief member descriptions after the members that are listed in # the file and class documentation (similar to JavaDoc). ... The default is NO. ...