... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• StructAlign help

... Simultaneous measurement of characteristics of bending and valence bands of water in D2 O solutions, KBr and KCl and using genetic algorithms in conjunction with variation methods allowed increasing accuracy of estimation of Fermi resonance coupling constant and of Fermi resonance contribution into formation of water Raman valence band. ... This energy transfer can explain existence of the shoulder in low-frequency part (in the region 3300 cm-1 ) of water Raman valence band. ...

Еще в разделе: (Показать все результаты (>18) - rswater.phys.msu.ru/ )

... Сотрудники . Ларин Александр Владимирович . ... Larin A.V., Leherte L., Vercauteren D.P. Approximation of the Mulliken-type charges for the oxygen atoms of all-siliceous zeolites // Chemical Physics Letters. ... Larin A.V., Parbuzin V.S.,Vercauteren D.P., Cumulative coordinate technique for approximation of high atomic multipole moments of aluminophosphate sieves on the basis of electron densities calculated with DFT methods, Int. J. Quantum Chem., ... Chem. ... Chem.Phys . ... Russ.J.Phys.Chem . ...

Еще в разделе: (Показать все результаты (>20) - beams.chem.msu.ru/ )

• Сверхзвуковые струи - Лаборатория молекулярных пучков МГУ

... Master Education . ... Master programs . ... objects, development and application of advanced mathematical methods and software to address problems in science, technology, economics and management.The Mathematics and Information Technology for Economic Activity Master ?s programme aims to prepare professionals in economics and finance ... This program aims to prepare high-qualified professionals for the commercial and government organizations in economics and the finance, including: . ...

Еще в разделе: (Показать все результаты (>3) - hcs.cmc.msu.ru/ )

... О кафедре . ... Научная работа . ... Главная Научная работа Математические модели взаимодействия элементарных и структурированных объектов . ... Ведущий научный сотрудник Эльтеков В.А. В разное время в состав группы входили: Н.Н.Шапошников, А.В.Овсянкин, В.Б.Шикалов, Н.Г.Васичкина (кафедра математики), Л.П.Развина, О.В.Попова, Н.Н.Негребецкая (кафедра физической электроники), В.Н.Самойлов, Н.Г.Ананьева (кафедра общей физики). ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>2) - matematika.phys.msu.ru/ )

• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Наши

... Home > Scientific laboratories > IM . ... The Laboratory of Industrial Mathematics (LIM) headed by Professor V.M. Goloviznin was established in the Faculty of Computational Mathematics and Cybernetics (CMC) of Lomonosov Moscow State University in 2011. ... In the area of energy and space, examples of topical engineering problems LIM is involved in, include the numerical simulation of new-generation atomic plants and computational aeroacoustics. ... Source URL: http://en.cs.msu.ru/laboratories/im . ...

Еще в разделе: (Показать все результаты (>50) - en.cs.msu.ru/ )

• Laboratory of Industrial Mathematics | CMC MSU
• Department of Algorithmic Languages | CMC MSU
• Department of Algorithmic Languages

________________________________________________ Space Environment (Natural and Artifical) Probabilistic model for fluences and peak fluxes of solar energetic particles Part I Protons Technical Specification ___________________________________________________________ ... Proton energy ­ [MeV]. ... Differential proton fluence energy (E) distribution in a single SEP event (or in a set of SEP events) [proton/(cm2·MeV)]. ... Probability for a given peak flux SEP with energy E to be exceeded. ...

Еще в разделе: (Показать все результаты (>7) - srd.sinp.msu.ru/ )

• http://srd.sinp.msu.ru/nymmik/models/quaghebeur_1.pdf
• http://srd.sinp.msu.ru/nymmik/models/quaghebeur_2.pdf
• http://srd.sinp.msu.ru/nymmik/models/bazilevskaya_1.pdf

... Geography of World Economy . ... Cryolithology and Glaciology . ... Departments . ... Research laboratories . ... Field stations . ... Type of field courses . ... Department of Cryolithology and Glaciology The Department was founded in 1945 with the name Department of northern countries . ... Our students are active members of PYRN (Permafrost Young Researchers Network), in which they share best practices, information about conferences, field courses, jobs. ... ISBN 5-89176-095-9 . ...

Еще в разделе: (Показать все результаты (>8) - eng.geogr.msu.ru/ )

• Department of Oceanology

... In particular, for "symmetric weights" we have a (x)f (x) dx, where (x) is an even weight function; the degree of the polynomial for the calculation of -a weights is decreased by two times, more precisely, P (x) = x f (x2 ), where P (x) is the polynomial of degree m = 2k + , k = [m/2], for determination of the weights, f (x) is a polynomial of degree k (here [... ] is the integral part). ... Now consider particular weight functions and calculate the formulas of the 10th and 14th orders of accuracy. ...

Еще в разделе: (Показать все результаты (>15) - shamolin2.imec.msu.ru/ )

... We calculate field dependence of the electron drift velocity using several sets of the material parameters that can be found in the literature, and the results are compared with the available experimental data. ... 0 2 Electronic mail: dmitriev@lt.phys.msu.su. ... The calculated field dependence of the drift velocity vd for different sets of InN material parameters, the lattice temperature is 77 K, the free electron, and doping concentrations are 9 1018 cm-3. ... Phys. 109, 023706 2011 FIG. ...

Еще в разделе: (Показать все результаты (>16) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/Dmitriev-Ivanov-Xoxlov-11-JMathSci-Diffuser.pdf
• http://lizard.phys.msu.su/home/science/Dmitriev-Tkaceva-14-JElectMat-PbTe.pdf
• http://lizard.phys.msu.su/home/science/rec-GaN.pdf

. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the

Еще в разделе: (Показать все результаты (>3) - optics.sinp.msu.ru/ )

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... This section presents the results of the application of the methodology described in the previous section to real EEG signal. ... Fig. 7.1. Detection algorithm adapted for the EEG analysis . The EEG (a) was filtered in the alpha band (bandpass 7.5--12.5 Hz) (b) and then the amplitude squared (c); the result is the sequence from which the subintervals are cut out at further steps. ...

Еще в разделе: (Показать все результаты (>24) - brain.bio.msu.ru/ )

... Bachelor Program . Master Program . ... The Department of Operations Research . ... researchers specialized in mathematical models and methods of economic regulations . ... possess a profound knowledge in the field of e со nometrics, risk theory, actuarial and financial mathematics, the theory of games, operations research, economic regulation on micro and macro levels . ... can use modern computer technologies in order to construct models and solve optimization problems . ... exam . ... test . ...

Еще в разделе: (Показать все результаты (>3) - io.cmc.msu.ru/ )

This module provides for the generation of Expires HTTP headers according to user-specified criteria. ... This module controls the setting of the Expires HTTP header in server responses. The expiration date can set to be relative to either the time the source file was last modified, or to the time of the client access. ... ExpiresByType . ExpiresDefault . The ExpiresDefault and ExpiresByType directives can also be defined in a more readable syntax of the form: . ... Module: mod_expires . ...

Еще в разделе: (Показать все результаты (>21) - neptun.sai.msu.ru/ )

... Laboratory of Medicinal Chemistry was established at the Department of Chemistry, Lomonosov Moscow State University in October 2013. ... We apply modern molecular modeling and chemoinformatics methods as well as develop new approaches. ... We have developed efficient methods for the analysis of quantitative structure-activity relationships and design of novel promising structures based on diverse theoretical approaches. ... Home . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>4) - qsar.chem.msu.ru/ )

... The main physical factor influencing sound propagation in the ocean is water motion altering the sound speed and, consequently, the travel time of the acoustic signal. ... This paper describes the method and results of an experimental investigation of acoustic signal travel time fluctuations on a super-long path Hawaii ­ Kamchatka. ... Using the M-sequence allows one to measure travel time fluctuations of acoustic signal propagating along different ray groups [Zverev and Stromkov, 2001]. ... Figure...

Еще в разделе: (Показать все результаты (>12) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E18_Poplavsky.pdf
• http://seac47-2.phys.msu.ru/proc/E15_Nosov_Kolesov.pdf
• http://seac47-2.phys.msu.ru/proc/E12_Marchuk.pdf

... Gerasimov, Y., Shorokhov, V., and Snigirev, O. Electron transport through thiolized gold nanoparticles in single-electron transistor.љ ... DOI љ] . ... Journal of Communications Technology and Electronics 56 , 12 (2011), 1483?1489. ... Malinin, V., Shorokhov, V., and Soldatov, E. Determination of electronic properties of molecular objects on the basis of nanodevices transport characteristics.љ Proceedings of SPIE - The International Society for Optical Engineering 7521 љ(2010), 75210?1?75210?10. ...

Еще в разделе: (Показать все результаты (>6) - cryolab.phys.msu.ru/ )