... education . ... Composite materials . Materials for solar and fuel cells . ... Registration deadline is 30 April 2012. ... New deadline is 15 May 2012 . ... Registration fee should be paid before 10 June 2012. ... For information please contact Mrs. Olga Bogomolova: obogomol@gmail.com and Dr. Alexander Chertovich: chertov@polly.phys.msu.ru . ...

Еще в разделе: (Показать все результаты (>42) - nano.msu.ru/ )

• Registration for the International School ?Computer simulation of advanced

... О UNИX . ... Неизменяемая страница . ... Page Header . ... logged in: shows your user name (links to your home page), provides a link to user preferences (Settings) and a logout link. ... Page path: shows the path of the page. ... Show "Общая информация о странице" , shows general information of the page . Show chart "Просмотры и исправления страниц" , shows page hits and edits count . ... Переименовать страницу , allows to rename this page . Удалить страницу , allows to delete this page . ...

Еще в разделе: (Показать все результаты (>127) - uneex.mithril.cs.msu.su/ )

• LecturesCMC/LinuxApplicationDevelopment2012/03/SecSem - UNИX

... Новости . ... Музей . антропологии . ... Вестник МГУ Антропология . ... 26 ноября Музее антропологии открылась этнографическая выставка . ... Антропология" . ... Посмотреть фотографии . ... 2008-2010 Научно-исследовательский институт и Музей антропологии им.Д.Н.Анучина . Копирование материалов web-сайта только с разрешения администрации НИИ и Музея антропологии МГУ! ... При использовании материалов, размещенных на сайте НИИ и Музея антропологии МГУ, ссылка на источник обязательна! ...

Еще в разделе: (Показать все результаты (>29) - www.anthropos.msu.ru/ )

... For 1st and 2nd-year students . Introduction to quantum physics . ... Contacts . ... 2003 2016 Department of Quantum Electronics . ... Еmployee * - Select - Fadeev Victor Fedyanin Andrey Kulik Sergei Panov Vladimir Penin Aleksandr Maslova Natalya Murzina Tatyana Nikulin Aleksandr Kitaeva Galiya Burikov Sergey Ezhov Alexander Muzychenko Dmitriy Oreshkin Andrey Prudkovskii Pavel Savinov Sergey Dolgova Tatyana Kuznetsov Kirill Lyubin Evgeny Maidykovsky Anton Shirshin Evgeny Straupe Stanislav . ...

Еще в разделе: (Показать все результаты (>29) - quantum.phys.msu.ru/ )

• Elyutin Pavel | Department of Quantum Electronics
• Dolgova Tatyana | Department of Quantum Electronics
• Dolenko Tatyana | Department of Quantum Electronics

... of Moscow State University Official Website . ... Faculty of Mechanics and Mathematics of Moscow State University, Russian Academy of Technical Sciences, Russian Academy of Natural Sciences, Council on Cybernetics of Russian Academy of Science, and Moscow Scientific Center for Culture and Information Technology organize the X International Conference "Intelligent Systems and Computer Science" at the Faculty of Mechanics and Mathematics of Moscow State University from December 05 to December 10, 2011...

Еще в разделе: (Показать все результаты (>148) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: Computer Solver
• Intelligent Systems :: Research :: Computer Teacher
• Intelligent Systems :: Science :: Conference :: 9th International Conference

International Laser Center of MSU . ... Scientific Laboratories . Science . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Home Science and education Scientific Laboratories Laboratory of computer simulations in optics . ... Dergachev Aleksandr Aleksandrovich Ph.D. Dormidonov Aleksandr Evgen'evich Ph.D. Kandidov Valeriy Petrovich Doctor of science . ... Femtosecond Nonlinear Optics of High Power Laser Radiation . Femtosecond TW Laser Pulse Filamentation in Gases and Condensed Media . ...

Еще в разделе: (Показать все результаты (>701) - ilc.phys.msu.ru/ )

• "Computers and measurements" practical course laboratory

. Dear Friends, . Please count this message as a Christmas card from me. Marry Christmas and Happy 2009! . Michael . _________________ . Michael B. Mensky . P.N.Lebedev Physical Institute . 119991 Moscow, Russia .

Еще в разделе: (Показать все результаты (>480) - chronos.msu.ru/ )

• Status of the Institute

... MIT OpenCourseWare (бесплатные учебные курсы Massachusetts Institute of Technology ) . ... UCSB CS140 - Parallel Scientific Computing: Winter 2007 . ... Scientific Computing for Engineers (Prof. Jack Dongarra, Department of Computer Science (CS) at the University of Tennessee, Knoxville) . Introduction to Finite Element Methods (ASEN 5007) Fall 2007 (Department of Aerospace Engineering Sciences, University of Colorado at Boulder) . ...

Еще в разделе: (Показать все результаты (>8) - ani.cs.msu.su/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU
• Courses

... Please retype /font /b /td /tr % } tr td class = form nbsp; b Your name: /b /td td class =formi input type=text size= 60 value= %$ author % name= author /td /tr tr td class = form nbsp; b Your e-Mail: /b /td td class =formi input type=text size= 60 value= %$ dbh->quote($author) . ... br>"); return -1; } my $last_id=DB_functions::get_max_id($dbh,$tree,'id'); my $parent = ($id>0)?$id:0; if (!$dbh->do("INSERT INTO $tree (id,parent,resource) VALUES ( $last_id," . ...

Еще в разделе: (Показать все результаты (>95) - www.kosmofizika.ru/ )

• http://www.kosmofizika.ru/includes/forum/showmessage.msn

... Инновационная . структура МГУ . ... Обучение инновационному менеджменту . ... Нормативно-правовая база инновационной . деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... Building on the objectives of your current business plan, you schedule a comprehensive series of promotional activities for your company. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>15) - innovation.msu.ru/ )

... Research . ... 1976 ? current: Moscow State University . ... Moscow State Institute of Foreign Languages (currently - Moscow Linguistic University), Translation Faculty, Department of Machine Translation . ... Degree granted through Moscow State University, Department of Structural and Applied Linguistics, V.A.Zvegintsev, Head . ... Russian State Humanitary University, Department of General and Applied Linguistics. ... Moscow State Linguistic University, Department of General Linguistics. ...

Еще в разделе: (Показать все результаты (>42) - lcl.srcc.msu.ru/ )

Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . Prof. Dr. Olga I. Vinogradova . Moscow State University . ... Research . ... Professor, Director of Laboratory . ... Type of research: . ... She then joined the group of Prof. Boris V. Derjaguin at the Laboratory of Physical Chemistry of Modified Surfaces, part of the A.N.Frumkin Institute of Physical Chemistry and Electrochemistry (Russian Academy of Sciences) as a research fellow. ...

Еще в разделе: (Показать все результаты (>54) - nanofluidics.phys.msu.ru/ )

• Theses
• Demekhin
• Dubov

The Department of Talented Youth Affairs and Professional Orientation . ... Older posts . Posted on 09.11.2015 by admin . ... The team competitions Continue reading . Posted in News , Без рубрики | Leave a comment . ... In the 2015/16 Continue reading . ... The festival is organized by the Department of Continue reading . ... Posted on 17.11.2014 by admin . ... Federal Agency for Youth Affairs ?Rosmolodezh?, ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>56) - talant.msu.ru/ )

... Terrestrial ecosystems . Research . ... Environmental pollution and protection in the Norwegian-Russian border area are the main themes of research cooperation between the Soil Science Faculty of Moscow State University (MSU) and the Norwegian Forest Research Institute (NISK). ... The bilateral scientific cooperation between Norway and Russia was established in 1988, based on joint governmental agreement on environmental problems. ... Norwegian Forest Research Institute, Norway . ...

Еще в разделе: (Показать все результаты (>25) - eco.soil.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• StructAlign feedback

... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>15) - ani.cmc.msu.ru/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU
• Courses | Department of the Automation for Scientific Research CMC MSU
• Courses

... Home . ... Board of directors . About the project . ... Read more . ... Project director . ... PhD, Research Associate . Director of the scientific part of the project . ... PhD, Deputy Vice-Rector . Technical Coordinator . ... Project coordinator . ... Coordinator of "Biological information" part of the project . ... Coordinator of "Human biomaterial" part of the project . ... Coordinator of "Animals" part of the project . ... Coordinator of "Plants" part of the project . ...

Еще в разделе: (Показать все результаты (>4) - depository.msu.ru/ )

• Contact | depozitariy

... The Study of Acoustic Nonlinearity Parameter Tomography in Reflection Mode . ... Based on the theory of propagation of reflected second harmonics in the layered medium and the insert-substitution method of finite amplitude sound wave, the computer simulation of nonlinearity parameter tomography from calculated reflected second harmonic data and filtered convolution algorithm used in the conventional CT technique is reported and the images of B/A for several biological specimens are reconstructed. ...

Еще в разделе: (Показать все результаты (>619) - acs366.phys.msu.su/ )

• AUTHOR : Popa M
• AUTHOR : Naidenova E
• Modern Group Analysis (MOGRAN 9)

. Итоги опубликованы на сайте . Marina Rykhlikova 24 марта 2006 00:36:21 . Уважаемая Галина Ивановна! . Итоги VII Телеконференции, как и всегда, опубликованы на сайте "ЭкоСодружества" в разделе "Телеконференция. Общие вопросы" в трех сообщениях: . http://ecocoop.ru/eco/messages/1661.html . http://ecocoop.ru/eco/messages/1662.html . http://ecocoop.ru/eco/messages/1663.html . С уважением, . М.Е. Рыхликова, руководитель Проекта .

Еще в разделе: (Показать все результаты (>1601) - www.ecocoop.ru/ )

• http://www.ecocoop.ru/hydro/messages/925.html
• http://www.ecocoop.ru/hydro/messages/1737.html
• http://www.ecocoop.ru/zoology/archive1/messages/462.html

Status of mTCA Slow Control development at CMS Petr Volkov Lomonosov Moscow State University Skobeltsyn Institute of Nuclear Physics, Russia 6/27/2015 P. Volkov SINP MSU 1 uTCA: Introduction MicroTCAў - open standard for fabric computer systems. MicroTCA systems are both physically small and non-expensive. ... Use PVSSII and the JCOP Framework to develop your control applications. These are the official CMS DCS developing tools. ... CMS_MTCA_HCALTR_CRATE1 CRATES.. ...

Еще в разделе: (Показать все результаты (>191) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/proceedings2015/Collider_Volkov.pdf
• QFTHEP