About BAFIZ . BAFIZ at SINP MSU . ... The main aims of the Project at SINP of MSU . ... Development of the Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE) at SINP of MSU . Development of the tools for Space Physics data utilization and processing . ... The communication infrastructure base of the Project at SINP of MSU is based on Radio-MSU Network . The computational base of the Project at SINP of MSU is Computing Center ALPHA . ...

Еще в разделе: (Показать все результаты (>33) - dbserv.sinp.msu.ru/ )

• Satellite Informations Sector
• ULYSSES Online Data Set Selector

I. (SCIENCE CITATION INDEX ­SCI) WEB OF SCIENCE Web of Science (WoS) , , , , , Web of Science. ... Search>. ... WEB OF SCIENCE (SCIENCE CITATION INDEX) , Web of Science <Cited Reference Search>, , <Search>. ... Russian Acad Sci, Boreskov Inst Catalysis, Siberian Branch; - RAS, Boreskov Inst Catalysis SB; - SB RAS, Boreskov Inst Catalysis; - Boreskov Inst Catalysis; - Inst Catalysis; - Novosibirsk Catalysis Inst; - Boreskov Inst Catalysis SB RAS; - Boreskov Catalysis Inst; - GK Boreskov Inst Catalysis. ...

Еще в разделе: (Показать все результаты (>29) - cryst.geol.msu.ru/ )

... Custom Query . ... Component . ... automata io requirements ui . ... В And В Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . Or В Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . ... Summary Component Milestone Status Owner Type Priority Resolution Created Modified Blocked By Blocking Reporter Keywords Cc . ...

Еще в разделе: (Показать все результаты (>588) - kodomo.cmm.msu.su/ )

• Custom Query ? Cyclyc Cell Automata

THE REETHERM DATA BANK FOR MODELING OF GEOCHEMICAL PROCESSES WITH PARTICIPATION OF RARE-EARTH ELEMENTS K.G.Morgunov, G.R.Kolonin, G.P.Shironosova Institute of Mineralogy and Petrography SB, RAS, Novosibirsk This study was supported by the Russian Fundamental Research Foundation (Project No. 98-05-65299) and by the program Universities of Russia - fundamental researches (grant 2787) Herald DGGGMS RAS 5 (15)'2000 v.2 URL: http://www.scgis ...

Еще в разделе: (Показать все результаты (>852) - geo.web.ru/ )

• http://geo.web.ru/COMPASS/geo.html
• Pletchov Pavel biography info
• Trusov Sergey's homepage Curriculum Vitae of Trusov Sergey Viktorovich

... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>9) - margaret.imec.msu.ru/ )

• teachers

Magnetism Department MSU . ... Magnetism department . ... Magnetic Laboratory was created in Moscow State University by professor Vladimir Arkad ev. ... In 1918 Arkad ev returned in MSU where he founded Moscow Magnetic Laboratory, which exists for a long time on the enthusiasm of their members. ... As the head of new department professor Nikolay Akulov was assigned. ... During the period since 1954 till 1987 the head of magnetism division was Eugeny Kondorsky. ... Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>37) - magn.phys.msu.ru/ )

... The 56th ASMS Conference on Mass Spectrometry took place in Denver (CO, USA), June 1-5, 2008. ... International conference "Mass Spectrometry and Allied Topics" is an annual meeting of the American Society for Mass Spectrometry (ASMS). ... ASMS was founded in 1969 and, as of 2008, has approximately 7000 members, working on scientific reseach and development in mass spectrometry methods and instruments. ... The 56th ASMS Conference on Mass Spectrometry lasted five days. ... FT-ICR mass spectrometry ....

Еще в разделе: (Показать все результаты (>22) - ani.cmc.msu.ru/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the
• Alexander Pozdneev at the SIAG/LA-SIMUMAT International Summer School on
• The ASR Department at the CMC Faculty of Lomonosov MSU

... The 56th ASMS Conference on Mass Spectrometry took place in Denver (CO, USA), June 1-5, 2008. ... International conference "Mass Spectrometry and Allied Topics" is an annual meeting of the American Society for Mass Spectrometry (ASMS). ... ASMS was founded in 1969 and, as of 2008, has approximately 7000 members, working on scientific reseach and development in mass spectrometry methods and instruments. ... The 56th ASMS Conference on Mass Spectrometry lasted five days. ... FT-ICR mass spectrometry ....

Еще в разделе: (Показать все результаты (>11) - ani.cs.msu.su/ )

• Alexander Pozdneev at the SIAG/LA-SIMUMAT International Summer School on
• The ASR Department at the CMC Faculty of Lomonosov MSU
• Prof. Dmitry P. Kostomarov at the Differential Equations and Topology...

... Snecma Moteurs (Groupe Snecma, France) . ... The Colloquium-458, organized by EUROMECH , will take place at Institute of Mechanics of Lomonosov Moscow State University (MSU) . ... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... France. ... S.-Petersburg State Techn. ...

Еще в разделе: (Показать все результаты (>4) - www.imec.msu.ru/ )

• Институт механики МГУ
• "Advanced Methods in Validation and Identification of Nonlinear Constitutive

. Moscow State University . Physics Department . Russian Academy of Sciences . Institute of Organoelement Compounds . Language: . RUS / ENG . Source: russia.ru, 09.2008 . Source: russia.ru, 09.2008 . The news are available in Russian only . Seminar of the Polymer Council of RAS . Seminar in Polymer Physics . Seminar in Electrochemistry

Еще в разделе: (Показать все результаты (>498) - polly.phys.msu.ru/ )

• State prize - Chair of Polymer and Crystal Physics

sparallel.ru . Older posts . Newer posts . Posted by admin . ... Continue reading . Posted in Разное . Мар 17 . ... В интернет-магазине Cityboots представлена последняя коллекция обуви от Fabi по доступной цене. ... Posted in Ботинки . ... Широко известный канадский бренд бюджетной мужской и женской обуви. ... Posted in Кросовки . ... Posted in Сандалии . ... совокупный доход, получаемый этими ?обуви? или ? ... Экологически чистая обувь, обувь которая ?дышит? ? ... обувь изо льна. ...

Еще в разделе: (Показать все результаты (>10) - sparallel.ru/ )

• sparallel.ru - Part 106
• Jook обувь | sparallel.ru

... Run engine.exe. ... Choose "Basic Channels" property sheet. Setup basic channels. ... The two channels with changing indicator are microphone inputs (left channel for close microphone and right one for far one), and the rest one are additional channels (left for photo sensor and right for breath sensor). ... Do not forget to reset and setup spectral channels after each new start of Engine program and after adding or modifiing of spectral channels (i.e. every time when you press Options button). ...

Еще в разделе: (Показать все результаты (>127) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research
• Intelligent Systems :: Research :: Information Monitoring
• Intelligent Systems :: News

... ECOLOGICAL COOPERATION" . ... Brjanskaja oblast, Dubrovskij rajon, Seshcha (village), School . Brjanskaja oblast, Djat'kovskij rajon, Bytosh (village), School . ... Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Borodino (village), School . Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Yardenikha (village), School . ... Moscow, Children's Ecological Center of the National Park "Losinyj Ostrov" - the coordinator of ecological work of 18 Korolev-town's schools . Moscow, School #222 . ...

Еще в разделе: (Показать все результаты (>69) - www.ecocoop.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . By national TV "NEW CHANNEL", UKRAINE. New quantum technology in the field of biocybernetics . ... NEW CYBERNETIC BODY WITH THE BEST QUALITY OF REAL LIFE. ... B контексте моей теории плазма, это не ионизированный газ, а форма материи, из которой состоит внутренняя структура частиц. ... NEW QUANTUM THEORY OF ATOM'S NUCLEUS PRESENTED BY THE AUTHOR, DR. KOSTIANTYN RASIN. ... NEW ERA OF QUANTUM TECHNOLOGIES JUST BEGUN.. ...

Еще в разделе: (Показать все результаты (>891) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Хотите жить дольше? 3 основных секрета

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

... Class . ... public class Schema . ... This is a set of ProtoVariable, the DimensionSet which is the union of the Dimensions used, and any global Attributes. ... contains (java.lang.String name) . ... Returns the set of attributes associated with this, also know as the "global" attributes. ... a new Array containing the elements of this set. public ProtoVariable get (java.lang.String name) . ... If a different ProtoVariable with the same name, was in the set, it is returned, otherwise null is...

Еще в разделе: (Показать все результаты (>73) - angel.cs.msu.su/ )

• NetCDF User's Guide for C
• ExtensionFileFilter
• : Class NetcdfFile

Russian . Next: Features searching Up: Data Analysis (Operations Menu) Previous: Reconstruction of 3D Images Contents Index . User can make surface section over curve. To do this you should create a desired curve using curve drawing regime (see ), and execute the command Convert Curve to Section . Desired section will be drawn in a new window. Russian . Next: Features searching Up: Data Analysis (Operations Menu) Previous: Reconstruction of 3D Images Contents Index Filonov 2005-02-04

Еще в разделе: (Показать все результаты (>145) - www.spm.genebee.msu.ru/ )

• Evgeny Menshikov
• Hysteresys calibration file generation
• Macrocommands

e-mail: sinelka@mail.ru) , , , , Family, MARRIAGE, Divorce, REMARRIAGE - , - . The slogan of all the revolutions is equality, but their real result is a change of one form of inequality for some another. Many revolutionaries strive for a higher social status, but that is possible only for very few. ... Many people divorce in order to create a new family which would be more successful than the present one. ... Many men and women cannot remarry or their new marriages also result in divorce. ...

Еще в разделе: (Показать все результаты (>67) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2013/1/16.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/3/12.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/2/05.pdf

... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...

Еще в разделе: (Показать все результаты (>3) - unesco.fgp.msu.ru/ )

... Research . ... Linguistic expeditions . ... Up to now the subjects to documentation were local dialects of Selkup, Ket, and Evenki. ... 1) creation and enlargement of multimedia computer archives of Selkup, Ket, and Evenki speech, which include sounding dictionaries and folklore texts and life-stories in audio, video, and graphic representation in local dialects of the surveyed villages; development of linguistic multimedia databases; . ... 8) research into the Selkup-Ket-Evenki language contacts; ....

Еще в разделе: (Показать все результаты (>42) - lcl.srcc.msu.ru/ )