ANNOTATION on the research of Anna.V. Zatseva (Shishlova), Ph.D. student (on the second year of the program) Research title: Formation and physicochemical properties investigation of ordered metal nanostructures on the surface of polymer films. ... Optical properties of the system: semiconductor (dielectric) substrate - polymer film - ordered ensemble of metal nanoparticles embedded in polymer surface layer is being investigated. ... The PS surface is proved to have viscoelastic properties. ...

Еще в разделе: (Показать все результаты (>31) - www.spm.genebee.msu.ru/ )

• Histogram
• Features searching
• Surface highlighting

... A Primer from the Reform of Personal Income Taxation in Russia Introduction. ... However, to use the welfare function one needs to aggregate individual preferences that can also be unknown. ... The derivations lead to the conclusion that the optimal marginal income tax rate is increasing as the elasticity of labor supply increases. ... In this paper we obtain the characteristics of the labor supply for different population groups to get the elasticities of labor supply with respect to a post tax...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./briedis.pdf

Below is a list of all of the modules that come as part of the Apache distribution. ... mod_actions Apache 1.1 and up . ... Sending files which contain their own HTTP headers . ... User authentication using text files . ... User authentication using Berkeley DB files . ... User authentication using DBM files . ... mod_browser Apache 1.2.* only . ... Replaced by mod_setenvif in Apache 1.3 and up . ... Logging of User Agents . ... Replaced by the mod_log_config module in Apache 1.2 and up . ...

Еще в разделе: (Показать все результаты (>59) - neptun.sai.msu.ru/ )

• Using Apache with HP MPE/iX
• Why We Took PEM Out of Apache
• Source Re-organisation

... In this case both the medium and the electric field depend on two space coordinates only. ... The classical modeling presentation is in apparent resistivity which reflects an electric field distribution on the earth's surface. ... An expression can be derived for the potential value in point M ([pic]): [pic], (4) where [pic] is the potential of the primary electric field, [pic] is the potential of the secondary electric field, defined by the surface charge distribution. ... pic] |[pic] | ...

Еще в разделе: (Показать все результаты (>46) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/shevnin/publ/128.pdf
• Theory of resistivity sounding

... A This result can be applied to a wide variety of data sets, including electricity bills1, street addresses, lengths of rivers, physical and mathematical constants, and processes described by power laws. ... Based on the plausible4 assumption that people who make up figures tend to distribute5 their digits fairly uniformly, a simple comparison of first-digit frequency distribution from the data with the expected distribution according to Benford's law had to show up any anomalous results. ...

Еще в разделе: (Показать все результаты (>9) - www.eng.math.msu.su/ )

... We study the effect of doping on the energy spectrum of a superlattice with intentional disorder related to fluctuations of the layer widths. Disorder-induced redistribution of carriers between the layers gives rise to Coulomb fields that shift the energy levels and produce a decrease in the width of the energy level distribution (vertical screening). ... This affects vertical hopping conduction, since these levels correspond to the "bottlenecks" of the effective resistance network. ...

Еще в разделе: (Показать все результаты (>68) - scon155.phys.msu.su/ )

• Theory of electronic properties of disordered semiconductors and systems with
• Igor P. Zvyagin
• Hopping in Quasi-One-Dimensional Disordered Solids: Beyond the Nearest-Neighbor

... CompHEP Models. ... CompHEP is based on an idea of the physical model. ComHEP Models are very simular to physical models in high energy physics, like Standards Model or MSSM. ... Two of them are versions of the Standard Model (SU(3)xSU(2)xU(1)) in the unitary and t'Hooft - Feynman gauges. ... Standard Model in Feynman gauge . ... This output can be written in LaTeX format and in the form of CompHEP model files, which allows one to start calculations of processes in the new physical model. ...

Еще в разделе: (Показать все результаты (>13) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]
• install [CompHEP]

... Eagle Broadband Picks Terremark NAP . Eagle Broadband Picks Terremark NAPEagle says it selected Terremark NAP of the Americas because of its secure and reliable connection to customers throughout the US. The NAP of the Americas will serve as the central distribution hub for Eagle IPTV solution. this industry trend continues to get traction, we are delighted to welcome Eagle Broadband as one of the first IPTV distributors to our facility, says Manuel Medina, chairman and CEO of Terremark. ...

Еще в разделе: (Показать все результаты (>26) - elana.sinp.msu.ru/ )

... Полная версия этой страницы: 'Crossed-Field' and 'EH' Antennas . Студенческий форум Физфака МГУ > Наука физика > Интересные задачи и познавательные вопросы . ... the square of the peak (electric or magnetic) dipole moment of the antenna. ... case of a linear (electric) antenna, and is the product of the peak current times the area . of the antenna in the case of a loop (magnetic) antenna. ... One suggestion for a small antenna is the so-called 'crossed-field' antenna [2]. ... Developer . ...

Еще в разделе: (Показать все результаты (>74) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Barclays Capital 2009
• Студенческий форум Физфака МГУ > STATISTICA (Excel устроит)

... Borisov A. V. , Karavaev Y. L. , Mamaev I. S. , Erdakova N. N. , Ivanova T. B. , Tarasov V. V. Experimental Investigation of the Motion of a Body with an Axisymmetric Base Sliding on a Rough Plane . ... Borisov A. V., Karavaev Y. L., Mamaev I. S., Erdakova N. N., Ivanova T. B., Tarasov V. V., On the dynamics of a body with an axisymmetric base sliding on a rough plane, Russian Journal of Nonlinear Dynamics, 2015, vol. 11, no. 3, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>75) - ics.org.ru/ )

Title Author Key words Suicides in the United Kingdom (1981­2011): dynamics, trends, especially S.V. Bogdanov, J.S. Bogdanova suicide, UK, men, women, age groups The dynamics completed suicides in the UK over the years 1981­2011. Discusses the distribution of suicides by sex, age. The geographical distribution of suicide mortality of the UK population by region. Abstract

Еще в разделе: (Показать все результаты (>9) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2015/2/11.pdf

. Fig. 1. A - Absorption spectrum of phytoplankton suspension from central area of the Baltic Sea. Values of absorption coefficients are averaged over spectral regions 400-550 nm (afl) and 400-700 nm (a S ). B - Spectrum of the light used to excite chlorophyll fluorescence in PrimProd fluorometer (1), and spectral distribution of underwater illumination in clear water at depths of 1 (2), 5 (3), and 20 m (4). Fig. 2. Histograms of km (A) and I 1/2 m (B) distribution, obtained at the stations of Baltic S ea.

Еще в разделе: (Показать все результаты (>13) - www.biophys.msu.ru/ )

• http://www.biophys.msu.ru/primprod/Antal2001/Fig3_4.htm
• http://www.biophys.msu.ru/primprod/Figures/Fig_r2.htm
• http://www.biophys.msu.ru/primprod/Figures/Fig_r4.htm

Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>6) - lmmqsp.sinp.msu.ru/ )

Proceedings of ICHIT- 06 26 February - 5 March 2006, Moscow, Russia LINEAR AND NONLINEAR ANALYSIS OF NUMERICAL METHOD FOR DNS OF TURBULENT CONVECTION IGOR B. PALYMSKIY Modern Academy for Humanities, Novosibirsk Branch , Novosibirsk, Russia, 630064 palymsky@hnet.ru Abstract We study the spectral characteristics of the numerical method for DNS of turbulent convectional flows. ... So far the full numerical simulation of 3-D turbulent convection is very complex problem demanding the large resources. ...

Еще в разделе: (Показать все результаты (>7) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2006/CD/Palymskiy2.pdf

... Cell il., ... 219-235 Reprints available directly from the publisher Photocopying permitted by license only © 2000 OPA (Overseas Publishers Association) N.V. Published by license under the Harwood Academic Publishers imprint, part of The Gordon and Breach Publishing Group Printed in Singapore -Tubulin Distribution in Interphase and Mitotic Cells upon Stabilization and Depolymerization of Microtubules I. A. Vorobjev*, R. E. Uzbekov, Yu. ... EXPERIMENTAL Cell cultures. ... 1993, J. Cell Sci. ...

Еще в разделе: (Показать все результаты (>32) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/alieva2000.pdf
• http://cellmotility.genebee.msu.ru/html/articles/alieva95.pdf
• http://cellmotility.genebee.msu.ru/html/articles/alieva97.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Comparison of protein phylogeny reconstruction methods

Twilight observations with MASS/DIMM B. Safonov Sternberg Astronomical Institute Moscow State University Comprehensive Characterization of Astronomical Sites, 2010 B. Safonov (Moscow State University) Twilight observations with MASS/DIMM SITE 2010 1 / 17 Why observe in twilight with MASS/DIMM? ... ASM includes 3 devices sensitive to background: guider, DIMM and MASS. B. Safonov (Moscow State University) Twilight observations with MASS/DIMM SITE 2010 2 / 17 Background in guider. ...

Еще в разделе: (Показать все результаты (>15) - site2010.sai.msu.ru/ )

• http://site2010.sai.msu.ru/static/doc/Site2010-Summary.pdf
• http://site2010.sai.msu.ru/static/doc/AOtarola_site2010.pdf

... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode ­ computer related 1) · Perform simulation , create trajectory file · Calculate properties timestep by timestep 2) · Perform ...

Еще в разделе: (Показать все результаты (>11) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/qprice.pdf
• Galina A. Tsirlina

... We calculate field dependence of the electron drift velocity using several sets of the material parameters that can be found in the literature, and the results are compared with the available experimental data. ... 0 2 Electronic mail: dmitriev@lt.phys.msu.su. ... The calculated field dependence of the drift velocity vd for different sets of InN material parameters, the lattice temperature is 77 K, the free electron, and doping concentrations are 9 1018 cm-3. ... Phys. 109, 023706 2011 FIG. ...

Еще в разделе: (Показать все результаты (>15) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/jap-06.pdf
• http://lizard.phys.msu.su/home/science/redistr-sst99.pdf
• http://lizard.phys.msu.su/home/science/redistr-sst99.ps.gz

... Исследования подтверждают, что фторхинолоны являются высокоактивными антибактериальными препаратами и применение их дешевле традиционно используемой парентеральной терапии, особенно, когда в расчет принимают затраты на подготовку и внутривенное введение антибиотиков. ... Эффективность фторхинолонов доказана клинической практикой и рядом исследований. ... Dan M., Siegman-Igra Y., Pitlik S., Raz R. Oral ciprofloxacin treatment of Pseudomonas aeruginosa osteomyelitis. ...

Еще в разделе: (Показать все результаты (>201) - www.nature.web.ru/ )