... Galeev Elfat Mikhailovich . ... Elfat Mikhailovich Galeev was born on 19.03.1952 in village Chur of Iak-Bodinskii region of Udmurtian Soviet Socialist Republic. After accomplishing his post-graduate studies in 1977 he was taken on the staff of the departmetn of general problems of control. ... He has been a professor of the department since 1998. ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...
. # . Home . Services . Interaction . Calculate Hydrogen bond, Water bridges and Hydrophobic interaction for . Home Browse Download Help About Us . List of complexes . Pfam families . SCOP families . Interaction classes . Interaction modes . GO terms . ERROR! File was not found. NPIDB team 2003 - 2016 . text .
... Вычисление обратной функции нормального распределения вероятности. SF51R_c вычисляет значение x такое, что x 1/(2 ) 1/2 e - t*t / 2 dt = P , - где P - заданное значение вероятности (0 < P < 1). ... A.J.Strecok, On the Calculation of the Inverse of the Error Function, Mathematics of Computation, 22(101), 1968. real sf51r_c (real *p, integer *ierr) . ... ierr - . ... когда заданное значение вероятности p не принадлежит интервалу (0, 1); значение функции полагается равным 3.4e38. utsf12_c - . ...
... Point-split stress tensor and the Green's function. ... Casimir effect for a massless scalar field between two plates with the Dirichlet boundary conditions: one-particle states between the plates, explicit energy regularization and renormalization using the smooth cutoff. ... Casimir tension of a massless scalar field between two plates with the Dirichlet boundary conditions using the Green's function technique (the `pressure' Tnn version). ... Casimir energy renormalization. ...
[
Текст
]
Ссылки http://theorphys.phys.msu.ru/education/aqft_slides/ExamSyllabus_Term1.pdf -- 85.1 Кб -- 01.06.2015 Похожие документы
... Simultaneous measurement of characteristics of bending and valence bands of water in D2 O solutions, KBr and KCl and using genetic algorithms in conjunction with variation methods allowed increasing accuracy of estimation of Fermi resonance coupling constant and of Fermi resonance contribution into formation of water Raman valence band. ... This energy transfer can explain existence of the shoulder in low-frequency part (in the region 3300 cm-1 ) of water Raman valence band. ...
... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Bohm limit DB=vrg/3: Emax Emax ush 0.3 Ze B Rsh c 1014(B/Bism) Z eV B Hillas criterion ! ... Voelk 2000; Kang Jones 2006) - Bohm diffusion in amplified magnetic field B2/8 = 0.035 u2/2 ( Voelk et al. 2005 empirical; Bell 2004 , Zirakashvili VP 2008 theoretical) - account for Alfvenic drift w = u + Va upstream and downstream - relative SNR rates: SN Ia : IIP : Ib/c : IIb = 0.32 : 0.44 : 0.22 : 0.02 Chevalier 2004 , Leaman 2008, Smart et al 2004, Berezinsky et al 2006 Das et al. ...
... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...
MATSYM - symbolic matrix processor . ... To use the program you will need a MAT file (liked CIR file: "User manual for CIRSYM program") of your system. ... In first string of MAT file enter any text you want to be the title of your system. ... Starting from string 2 (if is not comments - "*") enter the system element name, incident row and column and, optionally, its value. ... To generate a solution, run MATSYM.exe and enter "system_file_name.CIR" or click on the "ENTER" (in "MAT" case). ...
... The main physical factor influencing sound propagation in the ocean is water motion altering the sound speed and, consequently, the travel time of the acoustic signal. ... This paper describes the method and results of an experimental investigation of acoustic signal travel time fluctuations on a super-long path Hawaii Kamchatka. ... Using the M-sequence allows one to measure travel time fluctuations of acoustic signal propagating along different ray groups [Zverev and Stromkov, 2001]. ... Figure...
. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the
... Research programm of the laboratory-chair< . ... Laboratory-chair of Discrete mechanics on a microscopic scale . ... Thus the structures of the physical world are not physical objects but physical processes. ... The primitive entity is called a material point. ... The value of the property “existence” of the material point varies from “the material point does not exist” to “the material point exists” by this process. ... Let call this structure a dynamical graph or a d-graph. ...
... The two main ways of financing a business, equity financing and debt financing, will be discussed in this chapter. Equity Financing Equity capital is the amount of money that you and/or your partners put into the business or raise from other investors. Equity is not debt. While investors share in the profits (or losses) of the business, their investment is not a loan. ... Debt Financing With your equity capital in place, you are now in a position to approach lenders for a business loan. ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/methodsforfinancingfourcompany.doc -- 102.0 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/methodsforfinancingfourcompany.doc -- 102.0 Кб -- 27.10.2005 Похожие документы
... Home > Scientific laboratories > IM . ... The Laboratory of Industrial Mathematics (LIM) headed by Professor V.M. Goloviznin was established in the Faculty of Computational Mathematics and Cybernetics (CMC) of Lomonosov Moscow State University in 2011. ... In the area of energy and space, examples of topical engineering problems LIM is involved in, include the numerical simulation of new-generation atomic plants and computational aeroacoustics. ... Source URL: http://en.cs.msu.ru/laboratories/im . ...
... Grants . ... 2004 . ... i) Physical model of molecular machines based on the Kolmogorov-Fokker-Planck equations. (ii) Theoretical model of the 2D and 3D Brownian motion for simulation of protein dynamics in water. (iii) Stochastic, probability, and spectrum characteristics of the Brownian motion obtained using numerical methods and computer simulation. (iv) Raman spectroscopy data on enzyme (chymotrypsin) and enzyme-substrate complex and their interpretation using numerical and analytical results. ...
PRL 102, 118302 (2009) PHYSICAL REVIEW LET TE RS week ending 20 MARCH 2009 Direct Measurements of Hydrophobic Slippage Using Double-Focus Fluorescence Cross-Correlation Olga I. Vinogradova,1 Kaloian Koynov,2 Andreas Best,2 and Francois Feuillebois3 ... 75231 Paris Cedex 05, France (Received 29 January 2008; published 20 March 2009) We report the results of direct measurements of velocity profiles in a microchannel with hydrophobic and ... FIG. ... Phys. 119, 13106 (2003). ...
Research Interests . Main current projects: . The Continuous Wavelet Transform based on the solution of Partial Differential Equations and its applications . ... Mean-field description of Kinetic Aggregate's Growth and Disease Spead including Anomalous Diffusion. ... It is based on the reducing of this integral transform to the exact analytical representation as the series of the Bessel and Struve functions multiplied by the wavelet coefficients of the input function. ...