... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Geography of World Economy . ... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... About Faculty . ... Research laboratories . ... Type of field courses . ... Specialists of the same profile graduate from the branches of the Faculty, located in Sevastopol (Ukraine) and Astana (Kazakhstan). ... International programme in Natural Resource Management and Law offers a unique combination of Natural and Environmental Sciences and Science of Law. ...
. Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . Тема обращения: . Описание проблемы: . Введите почтовый адрес: . Войти в систему . Регистрация . Главная . Поиск . Статистика . О проекте . Помощь . Издательство: Springer-Verlag . Местоположение издательства: Heidelberg, Germany . ї 2011-2015 НИИ механики МГУ . Лаборатория 404. Все права защищены. обратная связь . Создать
... Senior Lecturer, Chair of General Physics, Physical Department, Moscow State University; Ph.D. Igor I. Vlasov . Senior Researcher, Center of Research in Natural Sciences, Institute of General Physics of RAS; Ph.D. Igor G. Persiantsev . ... The Nesmeyanov Institute of Organoelement Compounds of Russian Academy of Sciences. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...
... Scientific Laboratories . ... Main Science and education Scientific Laboratories Laboratory of solid-state lasers and coherent spectroscopy . ... The first experiments in the laboratory of solid-state lasers and coherent spectroscopy were done in 1974-1975 years. ... In 1980, the laboratory began more complex experiments on the base of picosecond lasers, namely experiments realizing nonstationary picosecond CARS of molecular gases (CARS-coherent antiStokes Raman scattering). ...
... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Chemists, Attention! Search on databases! ... Search on databases! [ re: olenka_chem ] . ... Search on databases! [ re: egoist ] . ... Из: IT UK CH . ...
... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...
... О кафедре . English . ... Department for Jewish Studies of Lomonosov Moscow State University . ... The Department for Jewish Studies (DJS) was established in 1998. ... The students take courses offered by the School (the Institute of Asian and African Studies), as well as courses offered by the Jewish Studies Department. ... The Department regularly accepts university teachers of Jewish and Israeli Studies from Russia and the FSU in order to upgrade their professional level. ...
... Field of research: Extragalactic astronomy. ... NASA Astrophysics Data System (ADS) Abstract Service . ... CADC Home Page . ... CCD Images of Galaxies . ... RUSSIAN LINKS . ... UA Astronomy Personal Home Page - Bill Keel . ... The Shape of the Rotation Curves of Edge-on Galaxies, by A.V.Zasov and A.V.Khoperskov, 2003. ... A Thickness of Stellar Discs, by A.V.Zasov, and D.V.Bizyaev, 2003 . Minimum Velocity Dispersion in Stable Stellar Disks, by A.V.Khoperskov, A.V.Zasov, and N.V.Tyurina, 2003 . ...
... GIREDMET, Moscow . ITAE RAS, Moscow . ... Institute of information, Moscow . ... Ответственный исполнитель с российской стороны - профессор А.В.Ведяев. ... Лаборатория Spintec, Лаборатория Луи Нееля национального центра научных исследований (г. Гренобль Франция) Ответственный исполнитель с российской стороны - профессор А.В.Ведяев. ... Ответственный исполнитель с российской стороны - профессор А.Б.Грановский. ... Ответственный исполнитель с российской стороны - доцент Н.С.Перов. ...
О кафедре . ... Курс общей физики . ... Специальные курсы для студентов кафедры . ... Молекулярная электроника . ... Добро пожаловать на сайт кафедры! Всего несколько лет назад нанотехнология появилась в поле зрения всеобщего внимания, в основном, как символ и содержание очередного этапа миниатюризации электроники. ... Кафедра общей физики и молекулярной электроники уже более пятнадцати лет занимается исследованиями в области нанотехнологий. ... 2016 Кафедра Общей Физики и Молекулярной Электроники ...
... The national strategic management system in Russian power industry is far from perfect and is in the process of its formation after a long period of radical reform in the industry. ... This article s goal is to offer a more adaptable conceptual model for national strategic management in a branch of economy (on the example of the electric power industry). ... National strategic management, power industry, conceptual model, level of environmental uncertainty. ... Public Administrarion". ...
The purpose of the space-physics lab exercises is to introduce the students to the methods of the measurements, to the modern conception of near-Earth space structure and the physical processes and phenomena occured in it. ... At present the reasearches and the teachers of the University and of other institutes participating in the project continue development of the the special space-physics lab exercises, and they are interested in your ideas concerning the future exercises. ...
. Compiled from literature sources . version 1.0 . Scientific name . Family . English common name . Native common names . General use . Specific uses . Reference
Lomonosov Moscow State University . ... Russian Language Program . ... The Department of the French Language of the Faculty of Foreign Languages and Area Studies . ... The Practical Course of French', 'The World of the French Language Literature' . ... The World of the French Language' (1st and 2nd languages), 'The Practical Course of Translation for the 1st and 2nd Foreign Languages (French)','The Theory of Translation (the French Language)', the specialized course 'Oral Translation') . ...
... О факультете . ... Лекторий МГУ . ... Новости ФББ . Новости МГУ . ... Лекторий МГУ: 19 апреля, Ольга Александровна Филатова . 2016 . ... Программа секции "Биоинженерия и биоинформатика" . ... Олимпиада ФББ МГУ . ... Факультет биоинженерии и биоинформатики был создан на базе НИИ ФХБ им.А.Н.Белозерского МГУ в 2002 году. ... Факультет биоинженерии и биоинформатики, комната 433. ... 2016 Факультет биоинженерии и биоинформатики . Московского Государственного Университета имени М.В.Ломоносова . ...
Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...
Institute of Theoretical Geophysics . ... Consortium for Electromagnetic Modeling and Inversion (University of Utah) . SJ Geophysics Ltd . INFOMINE / Geomine - Geological Exploration and Technology (Links collection) . ... Zonge Engineering: Geophysical Modeling . CEMI software developed at the Center for Electromagnetic Modeling and Inversion (University of Utah). ... AGI Res3Dinv - 3D Resistivity Inversion Software . RINVERT - Resistivity Models and Modeling (or Modelling) Software . ...
... Отдел культуры древности . Отдел культуры и науки средневековой Европы . Отдел христианской культуры . Отдел русской культуры . ... Mellon Foundation / University of Chicago Dissertation Year Fellowship. ... Francois Furet Travel Grant (summer travel to France). ... FLAS (Title 6) fellowship for summer study of Turkish. ... DAAD Fellowship for summer study in Germany. ... Humanities and Social Sciences Research Grant Summer 1998. ... Soros Graduate Fellowship (grant #H2B70H), 1 year. ...
... DRIVER: Understanding structure and properties of artificial amyloid-like fibrils for bionanotechnology applications . ... AREA: Physicochemical Biology, High Molecular Weight Compounds . ... AREA: High Molecular Weight Compounds . ... AREA: Structure and Dynamics of Atomic-Molecular Systems, High Molecular Weight Compounds . ... AREA: High Molecular Weight Compounds, Physical Chemistry, Physicochemical Biology . ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...