Title Author Key words Suicides in the United Kingdom (1981­2011): dynamics, trends, especially S.V. Bogdanov, J.S. Bogdanova suicide, UK, men, women, age groups The dynamics completed suicides in the UK over the years 1981­2011. Discusses the distribution of suicides by sex, age. The geographical distribution of suicide mortality of the UK population by region. Abstract

Еще в разделе: (Показать все результаты (>37) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/documents/umo/bologne/CONVENTION%20ON%20THE%20RECOGNITION%20OF%20QUALIFICATIONS%20IN%20THE%20EUROP.pdf
• http://www.socio.msu.ru/documents/umo/bologne/THEEUR~1.PDF
• http://www.socio.msu.ru/documents/umo/bologne/Message%20from%20the%20Salamanca%20Convention%20of%20European.pdf

... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...

Еще в разделе: (Показать все результаты (>4) - biophys.msu.ru/ )

... About CIE MSU . ... Useful Information . ... Vestnik CIE (in Russian) . ... Moskva, IPA: [m? skva]) the capital of Russia and the country s principal political, economic, financial, educational, and transportation center, located on the Moskva River. the city s population of 10.4 million permanent inhabitants within the city boundaries constitutes about 7% of the total Russian population. ... Moscow s road system is centered roughly around the seat of the Russian government, the Moscow Kremlin. ...

Еще в разделе: (Показать все результаты (>22) - www.cie.ru/ )

• Russian Language Programmes :: Academic Programmes :: CIE
• Admissions :: CIE
• Apply Online

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>248) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Таблетка-чип, заменяющая врача. умная таблетка, smart...
• Клуб выпускников МГУ: CRISIS IN THEORETICAL PHYSICS: THE PROBLEM OF SCIENTIFIC
• Клуб выпускников МГУ: Клуб выпускников Японского центра МГУ

... Otherwise we will never recognize you and your homeworks. ... Afterwards you can go ahead and upload your homework to the system. You can also find your rating. ... To upload Homework - choose the corresponding task and press "Submit". labadmin's blog . ...

Еще в разделе: (Показать все результаты (>48) - nanolab.phys.msu.ru/ )

History Plugin Shows a complete history of a topic. ... When using PatternSkin enabling the !HistoryPlugin changes the "History" link in the bottom action bar so it opens a page with a nice user interface where you can select the versions to compare. ... noci) | ... lib/Foswiki/Plugins/HistoryPlugin.pm== | ... Version: | ... 1.002 Corrected coding error that causes the plugin to fail with HISTORY tag in topic | ... Foswiki::Plugins::VERSION 1.024 | ... This topic: System > Plugins > HistoryPlugin . ...

Еще в разделе: (Показать все результаты (>1895) - wiki.cs.msu.ru/ )

• (backlinks in System Web) WebStatistics < System < Foswiki
• (backlinks in all Webs) WebStatistics < System < Foswiki
• PageOptimizerPlugin < System < Foswiki

Microsymposium 34, MS015, 2001 TO THE DISCOVERY OF THE "SOUTH POLE - AITKEN " BASIN. ... Head [2] and Spudis [1] suggested in their reviews that the existense of the structure identified later as the South Pole - Aitken baasin was first predicted on the basis of a relief analysis of the mountain ridges observed in the libration zone be Hartman and Kuiper [7], i.e. after the first images of the lunar far-side had been obtained. ... SOUTH POLE-AIKEN BASIN: V.I.Chikmachev et al. ...

Еще в разделе: (Показать все результаты (>72) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Symposium/sternber.doc
• http://selena.sai.msu.ru/Symposium/sternber.pdf
• Works of the Department of lunar and planetary research of GAISh MGU

... Master's Programme . ... On-line консультант . ... Master s Programme Enterprise Resource Management System has been developed basing on methodology from SAP, Oracle, Microsoft Companies, as well as the experience of national higher school and international universities. The key objective (mission) of the Programme is to educate professionals in the organization and implementation of projects aimed at deployment and maintenance of ERP systems at domestic enterprises. ...

Еще в разделе: (Показать все результаты (>3) - erp.cmc.msu.ru/ )

... A.V.Burlakov, M.V.Chekhova, O.V.Karabutova, D.Yu.Korystov, Yu.B.Mamaeva and S.P.Kulik, Interference of Biphoton Fields. Laser Physics (2001) - в печати. ... Phys.Rev.A, 64, 041803 (4 стр) 2001. ... 2001). ... 86, ?20, 4710 (2001). ... Д.Ю.Кoрыстов, С.П.Кулик, А.Н.Пенин. ... Письма в ЖЭТФ 73, 248-252 (2001). ... A.V.Burlakov, M.V.Chekhova, D.N.Klyshko, S.P.Kulik, A.N.Penin, D.V.Strekalov and Y.H.Shih, Interference Effects in Spontaneous Two-photon Parametric Scattering from Two Macroscopic Regions. ...

Еще в разделе: (Показать все результаты (>89) - qi.phys.msu.ru/ )

• Sergei Kulik: Scientific interest

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>22) - observ.pereplet.ru/ )

MSU . ... Every year since 2004, the MSU Science Park has conducted an educational program and an innovation project competition called Success Formula (www.successformula.ru). ... In collaboration with the Center of Technology Transfer at Moscow State University and the Chair of Innovation Economics, MSU Science park offers a wide range of educational programs like Success Formula as well as infrastructure projects geared to the incubation of new technology companies on the Moscow University site. ...

Еще в разделе: (Показать все результаты (>30) - www.sciencepark.ru/ )

• MSU Science Park - Services
• MSU Science Park - News
• MSU Science Park

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

The PROBLEM of ELECTRON and SUPERLUMINAL SIGNALS V.P. Oleinik Monograph is published in "Nova Science Publishers, Inc. ... The electron as an open self- organizing system 1 1 1 1 1 1 Physical ideas and main results The model of open system Equations for the vortex and potential components of electromagnetic field The self- acting field of electron Interaction of the field of electron with vortex electromagnetic field Action of the system of interacting fields. ... Superluminal signals and STR 2- 9. ...

Еще в разделе: (Показать все результаты (>332) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/discussions/kuznetsov_vremya.pdf
• The Finite and the Infinite: A New view on the problem
• Laboratory-chair of modelling the natural references of time

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>51) - www.kosmofizika.ru/ )

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>4) - theorphys.phys.msu.ru/ )

pic] The Ministry of Education of the Russian Federation The Scientific and Methodological Council on Foreign Language Teaching The (Russian) National Association of Applied Linguistics (NAAL) The Faculty of Foreign Languages and Area studies of Lomonosov Moscow State University DECent - The Distance Education Centre Dear colleagues, You are invited to participate in the 2nd International Scientific and Methodological ... Teaching and learning a foreign language at a distance. ...

Еще в разделе: (Показать все результаты (>5) - dist.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр дистанционного обучения.

... Electronic journal Issue 4. 10 september 2004 Vorontchuk, Cox III R.W. Developing a Competency-based Career Training and Professional Development Program for Latvia INTRODUCTION. ... With the support of a grant from the NISPAcee a team from the Latvian School of Public Administration, the University of Latvia and the University of Akron (Ohio, USA) prepared for the Chancellery of Latvia a proposal for the creation of a career-long professional development program for those in the civil service. ...

Еще в разделе: (Показать все результаты (>8) - e-journal.spa.msu.ru/ )

... Форумы > Аспирантура > Тема . ... Аспирантура в Порту, Португалия . ... Grant call on E-Careers site: . ... Research Grant . ... Position/ Grant: PhD Research Grant. Generic scientific area: Engineering. ... Location: University of Porto, Faculty of Engineering, Department of Informatics Engineering (FEUP-DEI), http://www.fe.up.pt . ... This PhD research grant requires the completion of a PhD at the Department of Informatics Engineering, Faculty of Engineering, University of Porto (FEUP-DEI). ...

Еще в разделе: (Показать все результаты (>93) - www.mmonline.ru/ )

• Стипендия LSI Logic для аспирантов МГУ
• MMOnline | Новости | Стипендия LSI Logic для аспирантов МГУ
• MMOnline | Аспирантура | Стипендия LSI Logic для аспирантов МГУ

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>53) - srcc.msu.ru/ )

• Laboratory of Informatics
• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial

... Catalog . ... This web application is brought to you by the following people (in alphabetical order): . Alexey Sergeev, markup issues . Artemy Tregoubenko , JavaScript code . Elena Glushkova, content management . ... We would like to acknowledge the usage of these open source technologies: . Django , web framework . PostgreSQL , database management system . ... SAMP-Webtools , set of JavaScript tools for SAMP-enabled web applications . Developed by the Team . ...

Еще в разделе: (Показать все результаты (>208) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Berkeley 53
• SAI OCL Catalog Berkeley 72
• SAI OCL Catalog Berkeley 71