... 2015 . ... The paper deals with the content, basic principles and features of "soft power" formation in Russian foreign policy. ... Russian diaspora abroad, the Russian Orthodox Church and foreign organizations of ex-graduates of Russian (Soviet) universities act as important channels and translators of Russia s "soft power". ... Russia, "soft power", public diplomacy, non-governmental organizations, information, communications, culture, cooperation, influence, interests, Russian diaspora. ...

Еще в разделе: (Показать все результаты (>370) - ee-journal.spa.msu.ru/ )

... Глава I. Корреляция электромагнитных полей в разнонаправленных модах.. ... I.1.1 Постановка задачи и идея эксперимента.. ... Влияние на двухфотонную интерференцию через форму рассеивающего объема .. ... Ш.1.1 Двухфотонная интерференция четвертого порядка (регистрация двумя детекторами).. ... IV.3 Двухфотонная интерференция в поле многомодовой накачки.. ... Глава V. Влияние на бифотонное поле в процессе распространения. ... V.3 Синтез состояний Белла .. ... V.3.2 Состояния Белла.. ... состояний Белла...

Еще в разделе: (Показать все результаты (>74) - qi.phys.msu.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . ... Тема "Web Content Manager - Server Tools Business Group" . ... Up-to-date, easy to navigate, intriguing, connected and localized web site for MS Server products. ... The person for this positions needs to have some technical knowledge (understanding of html and graphic types, etc), and to be logical regarding the delivery of content to site users in accordance with the goals the content owners seek to achieve . ...

Еще в разделе: (Показать все результаты (>545) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: "ЛЕН-КАРТОФЕЛЬ-ДИЕТА И ГЕНОФОНД ЧЕЛОВЕКА"

... Альфа-частица . ... Бета-частицы . ... Взаимодействие частиц . Вильсона камера . Виртуальные частицы . ... Гамма-излучение . ... Гравитационное взаимодействие . ... Детекторы частиц . ... Дифракция частиц . Доза излучения . ... Доплера эффект . ... Зеркальные ядра . ... Магнитный дипольный момент ядра . ... Масса частицы . ... Резонансы (резонансные частицы) . ... Синтеза реакции . ... Странные частицы . ... Субатомные частицы . ... Ускорители заряженных частиц . ... Элементарные частицы . ...

Еще в разделе: (Показать все результаты (>171) - nuclphys.sinp.msu.ru/ )

• E.L.Fainberg (right) International Seminar on high-energy physics problems,

MODx encountered the following error while attempting to parse the requested resource: . PHP Parse Error . PHP error debug . Error: . mysql_connect() [ function.mysql-connect ]: Too many connections . Error type/ Nr.: ... home/biochem/biochem.bio.msu.ru/docs/manager/includes/extenders/dbapi.mysql.class.inc.php . Line: . ... Line 87 source: . ... mysql_pconnect($host, $uid, $pwd) : mysql_connect($host, $uid, $pwd, true))) { . Parser timing . ... PHP: . 0.0148 s . ...

Еще в разделе: (Показать все результаты (>3) - www.biochem.bio.msu.ru/ )

LOCAL TSUNAMI WARNING AND MITIGATION _______________________________________________________________________________________________________________________________________ FOREWORD The Proceedings includes selected papers presented at the International Workshop "Local Tsunami Warning and Mitigation" (Petropavlovsk-Kamchatskiy, Russia, on September 1015, 2002). ... Additionally, the workshop was held in commemoration of the 50th anniversary of the 1952 Great Kamchatka Earthquake and Tsunami. ...

Еще в разделе: (Показать все результаты (>30) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Official information

. Перейти к основному содержанию . GPU Center of Excellence МГУ . Поиск . О центре . Новости . Конкурс проектов . Поддержка . Материалы . Контакты . Компания NVIDIA открыла прием заявок на программу поддержки аспирантов, использующих вычисления на GPU в своих исследованиях: . http://www.nvidia.com/content/research/graduate-fellowship-program.html .

Еще в разделе: (Показать все результаты (>14) - ccoe.msu.ru/ )

• About the CCOE at Lomonosov Moscow State University | CUDA Center of Excellence

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Olorin . ... Рейтинг: 412 . Отключить content-length . ... Рейтинг: 152 . Re: Отключить content-length [ re: Olorin ] . ... Re: Отключить content-length [ re: DarkGray ] . ...

Еще в разделе: (Показать все результаты (>3473) - www.snto-msu.net/ )

• Re: Новинки программного обеспечения - Public forum of MSU united student
• [linux] stardict and utf8 problem - Public forum of MSU united student networks
• postgres. Вопрос о работе планировщика, наверное :) - Public forum of MSU

... MSU's HPC HISTORY . ... In 1956, Research Computing Center (RCC) of Moscow State University received its first computer тАЬStrelaтАЭ. ... BESM-6 computer was and still is considered to be of great importance to USSRтАЩs/RussiaтАЩs history of computer development. ... Same year RCC received its first BESM-6 computer, and despite its serial number 13 it proved to be lucky for the Center. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ... Excursions to Supercomputing Center ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• APPLICATIONS: Inorganic Chemistry | Moscow University Supercomputing Center
• APPLICATIONS: Geology | Moscow University Supercomputing Center
• APPLICATIONS: Electronics and Acoustics | Moscow University Supercomputing

. Menu1 . MainPage

Еще в разделе: (Показать все результаты (>64) - www.inorg.chem.msu.ru/ )

• Supramolecular and Cluster Chemistry Group - Inorganic Synthesis Laboratory

... История курсов . ... close this panel . ... Выпускной класс . Старшие классы . Младшие классы . ... Прием на курсы . ... График мероприятий . ... Телефоны, адреса . График работы . ... Приветствуем вас на сайте Общеуниверситетских подготовительных курсов.  ... Обращаясь на курсы через форму "Задать вопрос", будьте внимательны при написании своего электронного адреса.  . ... Сайт общеуниверситетских . подготовительных курсов  . ...

Еще в разделе: (Показать все результаты (>4) - oupk.msu.ru/ )

Synthesis and Use of Iron Humates for Correction of Iron Deficiency Chlorosis in Higher Plants Tatiana A. Sorkina1, Natalia A. Kulikova2,3, Anna M. Necvetay1, Olga I. Philippova2, Galina F. Lebedeva2, and Irina V. Perminova 1 2 3 1 Department of Chemistry, Lomonosov Moscow State University, 119992 Moscow , Russia Department of Soil Science, Lomonosov Moscow State University, 119992 ... Another indicator of the efficiency of the sample as chlorosis corrector is iron content in shoots. ...

Еще в разделе: (Показать все результаты (>168) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2008/2008-kulikova-detoxifying.pdf
• http://www.mgumus.chem.msu.ru/publication/2008/2008-philippova-mitigating.pdf
• http://www.mgumus.chem.msu.ru/publication/2009/2009-kulikova-uptake.pdf

. In this section, the information on the contents of the issues of the Journal "Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika" can be found. The tables of contents of these issues, the annual indexes, the publisher's imprints, the abstracts of published papers as well as full texts of biographic and current information materials are presented.

Еще в разделе: (Показать все результаты (>226) - vestnik.math.msu.su/ )

. Skip to main content . X-COM parallel.ru . Главная . Возможности . Примеры . Дистрибутивы . Документация . Публикации . Обратная связь . О проекте . Свидетельства Роспатента ?2006611620 и ?2008614856 . Государственный контракт ?02.514.11.4035 от 18.05.2007 .   .

Еще в разделе: (Показать все результаты (>2) - x-com.parallel.ru/ )

Home Page Top ology on Graphs Title Page Contents Zhi Lu ? Institute of Mathematics, Fudan University, Shanghai. Page 1 of 22 Osaka, 2006 Go Back Full Screen Close Quit Home Page ї1. ... Title Page Contents Page 15 of 22 Go Back Full Screen Close Quit Home Page Basic problem (I) (, ): a coloring graph of type (n, n) with connected. ... Title Page Contents Page 20 of 22 Go Back Full Screen Close Quit Home Page Prop osition. ... Title Page Contents Page 22 of 22 Go Back Full Screen Close Quit ...

Еще в разделе: (Показать все результаты (>159) - higeom.math.msu.su/ )

• Geometry and Topology (English)

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

Psychology in Russia: State of the Art Volume 6, Issue 2, 2013 Russian Psychological Society Lomonosov Moscow State University structural dialectical approach in psychology : problems and research results Nikolay E. Veraksa*, Anastasiya K. Belolutskaya**, Irina I. Vorobyeva*, Eugene E. Krasheninnikov*, Elena V. Rachkova***, Igor B ... This evidence proves that dialectical thinking is a specific line of cognitive development in children and adults. ... Creativity and dialectical thinking]. ...

Еще в разделе: (Показать все результаты (>169) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/science/psyrussia/2013/frolova.pdf
• http://www.psy.msu.ru/science/psyrussia/2012/karpov.pdf
• http://www.psy.msu.ru/science/psyrussia/2012/ismagilova.pdf

... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.  ...

Еще в разделе: (Показать все результаты (>3) - siberian-lang.srcc.msu.ru/ )

. Название публикации . The transversal stiffness of fibers and the desmin content in the leg muscles of rats under gravitational unloading of various duration . Авторы . Ogneva I. Дата . 31.12.2009 23:00:00 . Название журнала . J. Appl. Physiol. Купить нет на складе . 2009 ФФМ МГУ, 2009

Еще в разделе: (Показать все результаты (>23) - fbm.msu.ru/ )

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>2) - saistud.sai.msu.ru/ )