... Simulation of an ideal quantum computer on a supercomputer "Lomonosov"' . ... This paper presents a simulation of an ideal quantum computer on a supercomputer "Lomonosov". ... Korzh O.V., e-mail: oxanad@mail.ru ; Korobkov S.V., e-mail: korobkovserg@gmail.com ; тАУ Moscow State University, Faculty of Computational Mathematics and Cybernetics; Leninskiye Gory 1-52, Moscow, 119991, Russia . ... Korzh A.A., e-mail: anton@korzh.ru тАУ T-Platforms Company; prospect Leninskii 113, Moscow, 117198, Russia . ...

Еще в разделе: (Показать все результаты (>203) - num-meth.srcc.msu.ru/ )

• "A problem of synthesis of nano-optical elements for the formation of dynamic
• "Simulation of a molecular structure formation as a result of thermal
• "Calculation of excited states of the polycation Bi 3+ 5 by the spin-orbit

________________________________________________ Space Environment (Natural and Artifical) Probabilistic model for fluences and peak fluxes of solar energetic particles Part I Protons Technical Specification ___________________________________________________________ ... Proton energy ­ [MeV]. ... Differential proton fluence energy (E) distribution in a single SEP event (or in a set of SEP events) [proton/(cm2·MeV)]. ... Probability for a given peak flux SEP with energy E to be exceeded. ...

Еще в разделе: (Показать все результаты (>7) - srd.sinp.msu.ru/ )

• http://srd.sinp.msu.ru/nymmik/models/quaghebeur_1.pdf

Light shift of coherent population trapping resonances R. Wynands'. ... 8, D-53115 Bonn Germany blnternational Laser Center. ... Russia ABSTRACT Although the frequency position of the non-coupled state in coherent population trapping does not depend on light intensities this is not true for the experimentally observed dark resonance minimum. ... Experimental setup for the sensitive detection of intensity-dependent frequency shifts of the coherent population trapping resonance in cesium vapor. ...

Еще в разделе: (Показать все результаты (>81) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/JETP-1998-86(1)-en.pdf
• http://qilab.phys.msu.ru/papers/JETP-2003-96(4)-en.pdf
• http://qilab.phys.msu.ru/papers/jetp-96(4)-2003-preprint-en.pdf

Statistical Methods in Data Analysis CERN Statistics helps to solve these problems: . ... Moscow, June 2002 F. James 1 Statistical Methods in Data Analysis CERN Probability All statistical methods are based on calculations of probability. ... Moscow, June 2002 F. James 3 Statistical Methods in Data Analysis CERN Bayesian Probability is more general, since it can apply even to unrepeatable phenomena (for example, the probability that it will rain tomorrow) . ... Moscow, June 2002 F. James 26 ...

Еще в разделе: (Показать все результаты (>43) - acat02.sinp.msu.ru/ )

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>30) - ideas.msu.ru/ )

... Physical Chemistry Division , . Department of Chemistry , . M.V.Lomonosov Moscow State University , . Moscow 119991 Russian Federation . ... Undergraduate student, Special Group for Physical Chemistry, Chemistry Department, Moscow State University. ... Physical Chemistry . ... 2005 - International Mendeleev's Chemistry Olympiad, Tajikistan - Silver Medal . 2006 - International Mendeleev's Chemistry Olympiad, Armenia - Gold Medal . ...

Еще в разделе: (Показать все результаты (>15) - lcc.chem.msu.ru/ )

Academy of Science, Engineering and Technology International Journal of Chemical, Nuclear, Metallurgical and Materials Engineering Vol :8 No:10, 2014 Kohonen Self-Organizing Maps as a New Method for Determination of Salt Composition of Multi-Component Solutions Sergey A. Burikov, Tatiana A. Dolenko, Kirill A. Gushchin, Sergey A. Dolenko Abstract--The paper presents the results of clusterization by Kohonen self-organizing maps (SOM) applied for analysis of array of ... T I. INTRO DUCTION water. ...

Еще в разделе: (Показать все результаты (>29) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/Assets/Water/J_Phys_ChemC_2012.pdf
• Laboratory of laser spectroscopy of solutions of supramolecular compounds and

... Earlier still lies the remaining frontier, where the first stars, galaxies and massive black holes formed. ... Building on this general framework, and relying on the development of efficient new computational tools, the fragmentation properties of primordial gas inside such minihaloes were investigated with numerical simulations, leading to the result that the first stars, so-called population III, were predominantly very massive4,8 (see Box 1 for the terminology used here). ... Astrophys. ... III. ...

Еще в разделе: (Показать все результаты (>15) - ocean.phys.msu.ru/ )

PRL 102, 118302 (2009) PHYSICAL REVIEW LET TE RS week ending 20 MARCH 2009 Direct Measurements of Hydrophobic Slippage Using Double-Focus Fluorescence Cross-Correlation Olga I. Vinogradova,1 Kaloian Koynov,2 Andreas Best,2 and Francois Feuillebois3 ... 75231 Paris Cedex 05, France (Received 29 January 2008; published 20 March 2009) We report the results of direct measurements of velocity profiles in a microchannel with hydrophobic and ... FIG. ... Phys. 119, 13106 (2003). ...

Еще в разделе: (Показать все результаты (>28) - nanofluidics.phys.msu.ru/ )

• http://nanofluidics.phys.msu.ru/paper/pre2006e.pdf
• http://nanofluidics.phys.msu.ru/paper/jcp20042.pdf
• http://nanofluidics.phys.msu.ru/paper/jcp2012_2.pdf

... Liyong Liu (NAOC) . Site testing on seeing conditions of the astronomical observatories over China are briefly reviewed, including Xionglong station of NAOC, Gaomeigu station of Yunnan Observatory, Delingha station of Purple Mountain Observatory. ... PDF [3.0€аMB] October 8, 09:55 10:20 . ... In this paper, we will review the site survey activities in the past years, and present the site-testing results on the Oma site, including cloud cover, seeing, water vapor, transparency and sky brightness. ...

Еще в разделе: (Показать все результаты (>29) - site2010.sai.msu.ru/ )

• The site testing programs in Antarctica and in Arctic
• Information

CATALOGUE OF SPACE STORMS . based on the list of selected geomagnetic disturbed days with mean daily Ap>20 in 1997-2009 . ... Description of the Catalogue . NN - number of event . ... 3d Map of Solar Events - Map of the solar events on the solar surface (see Map description ) occurred from four to two days before the geomagnetic disturbed day . 3d List of Solar Events - Solar Events occurred from four to two days before the geomagnetic disturbed day (obtained from Solar Event Reports ). ...

Еще в разделе: (Показать все результаты (>27) - dbserv.sinp.msu.ru/ )

• 1d Map Description
• 3d Map Description

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out

... Why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... Filters are used to remove low-complexity sequence because it can cause artifactual hits (please see Q: After running a search why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ...

Еще в разделе: (Показать все результаты (>146) - www.genebee.msu.ru/ )

• BLAST Reference Manual Pages
• GeneBee BLAST 2.2.8 Services Help
• GeneBee BLAST 2.2.22+ Services Help

... In strong floor model will with observed fact, gives the possible explanation bright heat radio sources, variable stars, stars with long life beside massive black holes. ... The Exponential dependency to energy from potential brings about that that under any differences potential field of the gravity, photon, flying to vertical direction, will not squander whole its energy (fig. ... The Index m also reminds that rm - minimum importance to which strives under collapse efficient radius of the star. ...

Еще в разделе: (Показать все результаты (>350) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/yatskar_interference.html
• http://temporology.bio.msu.ru/EREPORTS/sarli_mathematical_time.pdf
• http://temporology.bio.msu.ru/EREPORTS/parhomov_vlianie%20relikte.pdf

... Выпускники . Выпускники ВМиК . ... Женский клуб . ... Издательство МГУ . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... The Observer: Beauty salons fuel trade in aborted babies . Великобритания The Observer Magazine . Раньше говорили, что мы продаем Украину, - сказал один репортер. Теперь мы продаем маленьких украинцев, и, более того, по частям". ... Абортированные плоды вывозятся из Украины для использования в ходе незаконного косметического лечения, которое стоит тысячи фунтов. ...

Еще в разделе: (Показать все результаты (>150) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "The Observer: "Мы продаем маленьких
• Клуб выпускников МГУ: Гостевая книга

Observation of the J P C = 0-+ ( 1800 ) and J = 2-+ 2 (1880) mesons in the - decay PC P. Eugenio,1 A. I. Ostrovidov,1 G. S. Adams,2 T. Adams,1 Z. Bar-Yam,3 J. M. Bishop,4 V. A. Bodyagin,5, D. S. Brown,6 , N. M. ... 83209 10 Thomas Jefferson National Accelerator Facility, Newport News, Virginia 23606 (Dated: February 14, 2007) 2 1 A partial- wave analysis of the reaction - p - p at 18 GeV /c has b een p erformed on a data sample of 4,400 ... All waves with J 3 and L 3 had been tried in the fits. ...

Еще в разделе: (Показать все результаты (>57) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/nir/papers/NIM_CsI-D.pdf
• http://lav01.sinp.msu.ru/~vlk/report97_monet.ps
• http://lav01.sinp.msu.ru/nir/papers/PRD72001.pdf

Warning : oci_connect(): ORA-12543: TNS:destination host unreachable in / home / swx / public_html / models / sw_forecast.php on line 3 Warning : oci_parse() expects parameter 1 to be resource, boolean given in / home / swx / public_html / models / sw_forecast.php on line 4 Warning : oci_execute() expects parameter 1 to be resource, null given in / home / swx / public_html / models / ...

Еще в разделе: (Показать все результаты (>1276) - swx.sinp.msu.ru/ )

• http://swx.sinp.msu.ru/models/get_charea.php

... 4, 2014 DOI: 10.1007/s11664-014-3031-7 г 2014 TMS Calculation of the Thermoelectric Properties of n- and p-Type Lead Telluride Using a Three-Band Model of the Electron Energy Spectrum A.V. DMITRIEV 1,2 and E.S. TKACHEVA 1 1.- ... This expression is valid for any band. ... The averaged overlap integral Calculation of the Thermoelectric Properties of n- and p-Type Lead Telluride Using a Three-Band Model of the Electron Energy Spectrum 1283 I ?k; k0 о М 2 1X hk; ijk0 ; ji 4 iМ 1 ; 2 jМ1;2 2 w DA ?k; i ...

Еще в разделе: (Показать все результаты (>17) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/jap-06.pdf
• http://lizard.phys.msu.su/home/compu_sci/README.eng
• http://lizard.phys.msu.su/home/science/Dmitriev-Zvyagin-10-Uspekhi-final.pdf

International Laser Center of MSU . ... Home Science and education Scientific Laboratories Laboratory of solid-state lasers and coherent spectroscopy . ... The first experiments in the laboratory of solid-state lasers and coherent spectroscopy were done in 1974-1975 years. ... In 1980, the laboratory began more complex experiments on the base of picosecond lasers, namely experiments realizing nonstationary picosecond CARS of molecular gases (CARS-coherent antiStokes Raman scattering). ...

Еще в разделе: (Показать все результаты (>192) - ilc.phys.msu.ru/ )

... Nevertheless, in mammals and in other intron-rich organisms, many of the SSs often involve nonconsensus (Nc), rather than consensus (Cn), nucleotides, and beyond the two critical nucleotides, the SSs are not perfectly conserved between species. ... GBE exon intron exon intron exon Acceptor splice site Consensus Nonconsensus -24-23-22 -21-20-19-18-17-16 -15-14-13-12 -11-10 -9 -8 -7 -6 -5 -4 -3 -2 -1 +1 Position number -3 -2 Donor splice site -1 +1 +2 +3 Position number +4 +5 +6 FIG.1.- ...

Еще в разделе: (Показать все результаты (>7) - storage.bioinf.fbb.msu.ru/ )