... Data . ... This creates a powerful system for detecting proton and electron fluxes in the near-Earth space. ... Protons . ... Protons 1-100 MeV (horizontal das1) . ... MSGI SKL electron 0.1 MeV electron 0.3 MeV electron 0.7 MeV electron 4 MeV electron 8 MeV electron 13 MeV proton 1-100 MeV proton 3-10 MeV proton 8-65 MeV proton 10-28 MeV proton 30-260 MeV proton 55-95 MeV electron 0.1 MeV electron 0.3 MeV electron 0.7 MeV ...

Еще в разделе: (Показать все результаты (>33) - smdc.sinp.msu.ru/ )

• COHO project - Space monitoring data center
• Coronas-I - Space monitoring data center
• Cosmos-1686 - Space monitoring data center

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>3) - saistud.sai.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Comparison of protein phylogeny reconstruction methods

LOESS IN ARGENTINA: TEMPERATE AND TROPICAL (Report on the International Joint Field Meeting of the INQUA Loess Commission and Climates of the Past (CLIP) in Argentina). ... This field meeting, organised by Martin Iriondo and his co-workers, went from the heart of the Pampa (Carcara ? a basin, Santa Fe province) to the very north-eastern end of Argentina (the Iguazu falls), crossing the provinces of Entre Dos Rios, Corrientes and Misiones. ... Organization of this meeting was perfect. ...

Еще в разделе: (Показать все результаты (>456) - www.fadr.msu.ru/ )

• Klumpen?a Mesoscale Level of Classification for Soil Structure: Rationale
• Abstracts
• REPORT ON INTERNATIONAL SOIL SCIENCE CONGRESS (Montpellier, France, August...

... Some Features of a Laser Beam Diffraction at Nonlinear Acoustic Waves . ... At the beam diameter comparable to the acoustic wavelength, the diffraction maxima are modulated in intensity. There are acoustic wave harmonics in the modulation signal (output optical signal) [1]. ... Generally level of the first harmonic of a signal depends on a level only of first harmonic of a wave; the level of a second harmonic of a signal depends on a level both first and second harmonics of a wave, etc. ...

Еще в разделе: (Показать все результаты (>83) - acs366.phys.msu.su/ )

• Abstract (Invited)

... Полная версия этой страницы: Работа в Samsung . Студенческий форум Физфака МГУ > Общий > Работа . ... Telecommunication Network . ... Job Summary: The Optical Engineer will be involved in the design, fabrication and testing of optical/digital imaging system for mobile devices. ... Required Skills: Must have proven optical design and algorithm skills, lens design experience using code-V or equivalent lens design software. ... Company: Samsung Electronics Telecommunication Network Business . ...

Еще в разделе: (Показать все результаты (>327) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > youtube
• Студенческий форум Физфака МГУ > Короткое Замыкание, Горение дуги,
• Студенческий форум Физфака МГУ > RedHat про Sun & Micro$oft

... DEVISER . loosely-coupled Datalog EValuator Integrated with SchemE . ... Chair of System Programming . ... Documentation . ... DEVISER - is research project in progress, open-source system that can evaluate programs of language of logic programming of databases, Datalog. DEVISER involves the ideas of logic programming, database theory and functional programming. ... Nov 24 2006: DEVISER 1.2.1 is available: deviser-1.2.1.tar.gz . ... May 24 2004: DEVISER 1.2.0 is available: dtlog-1.2.0.tar.gz . ...

Еще в разделе: (Показать все результаты (>100) - sp.cs.msu.ru/ )

• HPF DVM. Language specification

... 2) to undertake multuaspectual reseach of textual and dictionary data using developing software, including combination and comparison of various classifications of textual and dictionary elements of Natural Language. Up to now in majority of cases systems for text processing, on the one hand, and systems for accumulation and analysis of dictionary data, on the other, are elaborated separately. ... It provides a user with ability to control and analyse some textual data. ...

Еще в разделе: (Показать все результаты (>39) - old.philol.msu.ru/ )

• Our publications
• MSU-LGCLL:: Main Page

Victor A. Safonov . ... V.A. Safonov. ... Russian Journal of Electrochemistry. ... V.A. Safonov, L.N. Vykhodtseva, A.A. Edigaryan, A.D. Aliev, E.B. Molodkina, A.I. Danilov, E.N. Lubnin, Yu.M. Polukarov. ... L.N. Vykhodtseva, G.E. Chusova, V.A. Safonov, V.N. Korshunov. ... L.N. Vykhodtseva, A.A. Edigaryan, E.N. Lubnin, Yu.M. Polukarov, V.A. Safonov. ... O.V. Safonova, L.N. Vykhodtseva, N.A. Polyakov, J.C. Swarbrick, M. Sikora, P. Glatzel, V.A. Safonov. ... V.A. Safonov, L.N. Vykhodtseva, Yu. ...

Еще в разделе: (Показать все результаты (>55) - electr003.chem.msu.ru/ )

• Laboratory of Electrical Double Layer and Electrode Kinetics
• Maria A. Choba: Selected Publications

... Event generation+Geant simulation of detector) For this, do you need a sophisticated baseline model of your event generator ? ... How to produce heavy state in PYTHIA? ... 350 (2001) EPOS for pp 15 MPI@LHC 2011, DESY, Hamburg, Klaus WERNER, Subatech, Nantes EPOS for heavy ion 16 Same framework extended pp AB EPOS for heavy ion 17 In heavy ion collision / or very high energy pp scattering : The usual procedure has to be modified, since the density of strings will be so ...

Еще в разделе: (Показать все результаты (>42) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~igor/seminar/CorrFlow_In_AMPT_vlk.pdf

The final deadline for pre-registration and abstract submission is 20 May 2002. ... Workshop Proceedings are available for download. 30 Sep 2002 . Information on Workshop Proceedings . 28 Aug 2002 . Venue of the Workshop . 12 Jul 2002 . Workshop program is available now! ... 24 May 2002 . Visas to Russia? ... Information on accomodation in Petropavlovsk. New topic "1952 Kamchatka tsunami" was added. ... Information . ... Tel: 7(095) 939-3698 Fax: 7(095) 124-8713 . ...

Еще в разделе: (Показать все результаты (>22) - seac47-2.phys.msu.ru/ )

... Academician Tishkov V.A., Pivneva E.A. Ethnologic and Anthropological Researches in the Academic Science of the Russian Academy of Sciences . ... World System of the Power Safety: History and Prospects . ... ACADEMIC LIFE . ... Ethnologic and Anthropological Researches in the Academic Science of the Russian Academy of Sciences . ... World System of Power Safety: History and Prospects . In the article the problems of the world power safety are analyzed. ... Keywords: World System, Power Safety . ...

Еще в разделе: (Показать все результаты (>81) - hist.msu.ru/ )

• Project "The Labour Relations Evolution in Russian Industries"

... Carnosine as a natural antioxidant and geroprotector: from molecular mechanisms to clinical trials. ... Carnosine is a neuroprotective dipeptide consisting of beta-alanine and L-histidine. ... Recently, carnosine was successfully used to treat patients after brain stroke or patients with Parkinson disease. We conclude that carnosine can be recommended for patients under oxidative stress as a natural remedy having high efficiency and no side effects. ...

Еще в разделе: (Показать все результаты (>72) - biochem.bio.msu.ru/ )

• Generation of recombinant antibodies and means for increasing their affinity.

... Женский клуб . Активное долголетие . ... Издательство МГУ . ... МГУ им.Ломоносова . ... Выпускники МГУ . ... Долголетие и омоложение . Дайв-Клуб МГУ . ... Ученые Миланского университета сделали очень уникальное и важное открытие. ... Этот особый коктейль состоит из аминокислот - валина, аминоизокапроновой кислотой и изолейцина. Возможность увеличивать срок жизни с помощью этого коктейля аминокислот доказано в лабораторных условиях на здоровых мышах среднего возраста мужского пола. ...

Еще в разделе: (Показать все результаты (>164) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Конференция "Бизнес-инкубатор"

... American), headings and the style of referencing. ... The opening page of a contribution in the NATO book series should always be a right hand page and should consist of: the title in capital letters, bold font, flush left, on the fourth text line; followed by the subtitle (if present) in italics, flush left, with one line of white above. ... First-order Heading This heading is in bold, upper and lowercase letters, numbered in arabic figures, and has two lines of space above and one line below. ...

Еще в разделе: (Показать все результаты (>124) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2008/2008-vladimirov-comparison.pdf
• http://www.mgumus.chem.msu.ru/publication/2008/2008-nikolaev-development.pdf
• http://www.mgumus.chem.msu.ru/ihss/pdf/IHSS15-Flyer.pdf

Composition of an Efficient Portfolio in the Bielecki and Pliska Market Model / Kambarbaeva G.S. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>30) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika

... IBM? SPSS? ... 20 User?s Guide (PDF) . ... полезные ссылки фото IRT психометрика тестирование юзабилити мотивация исследования статьи выбор профессии big data психодиагностика статистика эмоциональный интеллект hr корреляция поиск скачать SPSS организационная психология презентация юмор анализ и визуализация данных профессии тесты видео ссылки эксперименты апробация теста онлайн-сервисы dropbox геолокация психологические журналы книги психологическое тестирование AMOS виртуальные ...

Еще в разделе: (Показать все результаты (>7) - tukachev.flogiston.ru/ )

• Tag: КФА
• Category: Новости

. This document is designed to be viewed using the frames feature. If you see this message, you are using a non-frame-capable web client. Link to Non-frame version.

Еще в разделе: (Показать все результаты (>25) - angel.cs.msu.su/ )

• Summary
• : Package ucar.multiarray
• : Package ucar.netcdf

... TernAPI program . ... TernAPI program is designed for ternapy phase diagrams calculation by means of the convex hull method. ... Quick calculation of isobaric-isothermal sections of ternary systems phase diagrams (1-30 sec.) ... Voskov A.L., Dzuban A.V., Maksimov A.V. TernAPI program for ternary phase diagrams with isolated miscibility gaps calculation by the convex hull method // Fluid Phase Equilib . ... Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>4) - td.chem.msu.ru/ )

... A new method is proposed that makes it possible to determine the parameters of the three-dimensional (3D) multiwell potential of off-center atoms from extended X-ray absorption fine-structure (EXAFS) data. ... The parameters of the multiwell potential for Ge atoms in the Sn 1-x Ge x Te solid solution as functions of temperature and composition (77<T<300 K, x>0.4) were obtained in the classical approximation. ...

Еще в разделе: (Показать все результаты (>47) - scon155.phys.msu.su/ )