LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ HYDROACOUSTIC ANTENNA : A POWERFUL TOOL TO FORECAST TSUNAMIGENIC EARTHQUAKES Yakov S. Karlik Central Research Institute MORPHYSPRIBOR , 46 Chkalovsky proezd, Sankt-Petersburg, 197378 Russia E-mail: karlik@mail.cl.spb.ru ABSTRACT Hydroacoustic antenna ... 2001). ... Eiby, J.A., 1982: Earthquakes. ...

Еще в разделе: (Показать все результаты (>27) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E12_Marchuk.pdf
• http://seac47-2.phys.msu.ru/proc/E16_Nosov_Skachko.pdf

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>36) - ideas.msu.ru/ )

• http://ideas.msu.ru/news/19_10_2010/Press_release.pdf

Laboratory of Informatics . Head of Laboratory E.S.Polischuk, senior researcher, DSc . ... research guidance of a four year student's project in the Faculty of Geography (N.M. Chernavskaya, DSc) . ... Grant of RFBF (Russian Foundation for Basic Research) 01-03-00332, the head of the project prof. R.B.Rybakov, Institute of Orientalistic (Russian Academy of Science), N. M. Chernavskaya - performer . ... N.M.Chernavskaya, DSc, senior researcher, T.B.Pleskacheva., DSc, senior researcher. ...

Еще в разделе: (Показать все результаты (>121) - srcc.msu.ru/ )

• Laboratory of Systems for Automated Image Processing

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... about ERC . education . research . events . ... Being an effective way of acquiring knowledge, they also make a good addition to core lecture courses and involve students, postgraduates and scientists of other Russian higher education institutions and research centers in ERC activity in the initial stage. ... More information can be found at http://polly.phys.msu.ru/ru/unc/sconf.html . ... Conference on Development Prospects of Education and Research Centers in the Russian Federation . ...

Еще в разделе: (Показать все результаты (>23) - nano.msu.ru/ )

... To create a Hysteresys calibration file user should do the following: . Nodal points with known distances between them should be marked using poly line (Curve) on the obtained image of a calibration sample. ... Figure 2.12: Table that allow to define points that are needed for calibration plots generation. ... In this case user should obtain two separate calibration files for fast and slow scanning direction(x-calibration Х y-calibration-slow). ... Then we should unite these two files in one. ...

Еще в разделе: (Показать все результаты (>103) - www.spm.genebee.msu.ru/ )

• Macrocommands
• FemtoScan Online FAQs

... The 56th ASMS Conference on Mass Spectrometry took place in Denver (CO, USA), June 1-5, 2008. ... International conference "Mass Spectrometry and Allied Topics" is an annual meeting of the American Society for Mass Spectrometry (ASMS). ... ASMS was founded in 1969 and, as of 2008, has approximately 7000 members, working on scientific reseach and development in mass spectrometry methods and instruments. ... The 56th ASMS Conference on Mass Spectrometry lasted five days. ... FT-ICR mass spectrometry ....

Еще в разделе: (Показать все результаты (>30) - ani.cmc.msu.ru/ )

• Alexander Pozdneev at the SIAG/LA-SIMUMAT International Summer School on
• Prof. Dmitry P. Kostomarov at the Differential Equations and Topology...
• English edition of the ASR Department website

... The 56th ASMS Conference on Mass Spectrometry took place in Denver (CO, USA), June 1-5, 2008. ... International conference "Mass Spectrometry and Allied Topics" is an annual meeting of the American Society for Mass Spectrometry (ASMS). ... ASMS was founded in 1969 and, as of 2008, has approximately 7000 members, working on scientific reseach and development in mass spectrometry methods and instruments. ... The 56th ASMS Conference on Mass Spectrometry lasted five days. ... FT-ICR mass spectrometry ....

Еще в разделе: (Показать все результаты (>16) - ani.cs.msu.su/ )

• Alexander Pozdneev at the SIAG/LA-SIMUMAT International Summer School on
• Prof. Dmitry P. Kostomarov at the Differential Equations and Topology...
• English edition of the ASR Department website

Modelling signalling networks for explaining synthetic gene interactions leading to invasive phenotype in colon cancer mouse model I. Kuperstein 1 1,2,3 , D. P. A. Cohen 2 1,2,3 , L. Calzone 1,2,3 3 1,2,3 , M. Chanrion1, D. Louvard1, S. 2,3 Robine1, A. Zinovyev and E. Barillot1, Institut Curie, INSERM U900, Ecole des Mines ParisTech, Paris, France inna.kuperstein@curie.fr Molecular interactions in cell create an interconnected network with multiple cross talks and regulatory loops. ...

Еще в разделе: (Показать все результаты (>259) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/5.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/215.pdf
• OMICS Startup Contest

... Поиск по МГУ | Лента новостей | ... О проекте . ... Please, enter the code that you see below in the input field. This is for blocking bots that try to post this form automatically. If the code is hard to read, then just try to guess it right. If you enter the wrong code, a new image is created and you get another chance to enter it right. ... 2003 2011 MsuNews.Ru Новости МГУ . 2003 2011 Разработка и дизайн MMForce.Net . ... Экспорт новостей (RSS) ...

Еще в разделе: (Показать все результаты (>23) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ
• MsuNews.Ru | Блог проекта
• MsuNews.Ru | Энциклопедия

MSU . Science Park . ... 2-4 June 2014, Moscow hosted the Third International Summit of technology parks and business incubators "Technoparks as new drivers of national economic development." ... To do this for three days at the III Summit held an educational seminar "Managing effective business incubators and technology parks" with American colleagues - Heads of existing industrial parks and technology transfer centers. ... JSC MSU Science Park. ...

Еще в разделе: (Показать все результаты (>13) - www.sciencepark.ru/ )

• MSU Science Park - Projects & Partners
• MSU Science Park - Prototyping center
• MSU Science Park - About us

. Attached is an image of the Nova in M32. It was made under uncomfortable conditions, as our summer here in Germany makes a clear sky a rare event. To create this image, 5 images of 45 seconds each were summed. It was taken on September 12, at 21h 45m UT. Udo Zlender - Udo.Zlender@gmd.de . Back to Supernovae in NGC and IC galaxies. David Bishop Last modified: Thu Sep 17 12:41:25 EDT 1998

Еще в разделе: (Показать все результаты (>153) - www.rochesterastronomy.org/ )

• Supernova 2001V in NGC 3987
• Bright Supernovae pages - Updates 1998
• Supernova 2000cs in MCG +7-34-15

... MSU's HPC HISTORY . ... 2.5PF "LOMONOSOV-2" . 1.7PF "LOMONOSOV" . ... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Performance System Analysis . ... Former Russian President Dmitry Medvedev and the President of Moscow State University Victor Sadovnichy at the Lomonosov supercomputer presentation . т??Lomonosovт?? supercomputer was installed at the Moscow State University in 2009. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• Supercomputing Education Project | Moscow University Supercomputing Center
• SIGMA: Collective Bank of Tests on Parallel Computing | Moscow University
• Nationwide Supercomputing Education Project | Moscow University Supercomputing

I. (SCIENCE CITATION INDEX ­SCI) WEB OF SCIENCE Web of Science (WoS) , , , , , Web of Science. ... Search>. ... WEB OF SCIENCE (SCIENCE CITATION INDEX) , Web of Science <Cited Reference Search>, , <Search>. ... Russian Acad Sci, Boreskov Inst Catalysis, Siberian Branch; - RAS, Boreskov Inst Catalysis SB; - SB RAS, Boreskov Inst Catalysis; - Boreskov Inst Catalysis; - Inst Catalysis; - Novosibirsk Catalysis Inst; - Boreskov Inst Catalysis SB RAS; - Boreskov Catalysis Inst; - GK Boreskov Inst Catalysis. ...

Еще в разделе: (Показать все результаты (>18) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/courses/crchem/urusov2.pdf

Particle pair production in strong EM field, Imaginary temperature and field emission Boris Levchenko SINP MSU, Moscow Tunneling processes (Nature, adv. technologies) Electron field emission from metals: quantum theory by Fowler and Nordheim Results by Sauter and Schwinger for electric field in vacuum Condensed matter .vs. ... QFTHEP'10, BB Levchenko Pair production 16 Scheme of probing strong-field QED in the collisions of a 50-GeV electron beam with a focused laser beam. ...

Еще в разделе: (Показать все результаты (>217) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/rep_M_QFTHEP.pdf