... Salmonella typhimurium LT2, section... 147 9e-36 >AE008909 AE006468 |AE008909| ... Sbjct: 9915 aaacataaagtgatcgccagctgctttttcgaagcctc 9878 Database : fg Posted date: Dec 18, 2007 6:08 PM Number of letters in database : 12, 243 ,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 21,910 Number of extensions: 1351 ...

Еще в разделе: (Показать все результаты (>13833) - kodomo.fbb.msu.ru/ )

• allpy: 24a058450d72 debian/rules
• allpy: cf24b0082aa0 debian/rules
• Help: hgignore

... Snecma Moteurs (Groupe Snecma, France) . ... The Colloquium-458, organized by EUROMECH , will take place at Institute of Mechanics of Lomonosov Moscow State University (MSU) . ... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... France. ... S.-Petersburg State Techn. ...

Еще в разделе: (Показать все результаты (>2) - www.imec.msu.ru/ )

• "Advanced Methods in Validation and Identification of Nonlinear Constitutive

GRID WARPING IN TOTAL VARIATION IMAGE ENHANCEMENT METHODS Andrey Nasonov, and Andrey Krylov Lomonosov Moscow State University, Moscow, Department of Computational Mathematics and Cybernetics, e-mail: nasonov@cs.msu.ru, kryl@cs.msu.ru ABSTRACT An approach of including warping algorithms into total variation image enhancement methods is suggested. ... Index Terms-- Image grid warping, total variation, image enhancement 1. ... Interpolate the image from the warped grid to the old uniform grid. ...

Еще в разделе: (Показать все результаты (>822) - imaging.cmc.msu.ru/ )

• View publication | Laboratory of Mathematical Methods of Image Processing

... Toric Topology studies torus actions on manifolds and cell complexes whose orbit quotients have a rich combinatorial structure. ... Research proposal by T.Panov on toric topology for 2007-2009, supported by the grant of the Pierre Deligne Foundation of 2006: English summary , proposal (in Russian) . Research proposal by T.Panov on toric topology for 2011-2013, supported by the grant of the Dynasty Foundation of 2010: English summary , proposal (in Russian) . ...

Еще в разделе: (Показать все результаты (>237) - higeom.math.msu.su/ )

• Conferences (English)
• Publications (English)
• Publications (Russian)

... Include the full title of the paper: 20 pt Times New Roman, Bold, Cap/lowercase, centered Drop 24pt Include authors' initials followed by last name: 14 pt Times New Roman, Cap/lowercase, centered. ... Use 10 pt Times New Roman, Cap/lowercase, centered. ... Tables are Position the caption 6mm (1/4 inch) below the width of the text area; if the caption runs shorter The caption format: Type the word ``TABLE n'' (n=table number) in 10 pt Times New Roman, BOLD CAPS , followed by a period. ...

Еще в разделе: (Показать все результаты (>413) - acs366.phys.msu.su/ )

• Abstract (Invited)
• Abstract

To get Russian visa, you should do the following: . ... With two these papers from Academservice (hotel voucher and visa support) and some other required papers you go to Russian Consulate to apply for the visa. ... number of reference" in Foreign Ministry of Russia (it is 2454, under that 26605) Having those "numbers" Academservice has not to send any more papers to Russian consulates, it is enough for you to have the visa support and the hotel voucher FAXed from the Company. ...

Еще в разделе: (Показать все результаты (>57) - acat02.sinp.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

SEMINAR Singular Perturbations and Time Scales (SPaTS) in Control Theory and Applications 14:30 PM, Saturday, June 23, 2012, Room 5-18 Faculty of Physics, M.V. Lomonosov Moscow State University , Moscow, Russia Professor D. Subbaram Naidu , PhD, PE, Fellow IEEE Director and Professor, School of Engineering Director, Measurement and Control Engineering Research Center Idaho State ...

Еще в разделе: (Показать все результаты (>21) - matematika.phys.msu.ru/ )

Conference on 'Reflections on the atomic nucleus', 28.06.2015, Liverpool, UK. This meeting, see http://ns.ph.liv.ac.uk/Reflections2015 , will touch upon a few sub-topics of current interest in nuclear structure physics including aspects of nuclear collectivity, strengths, shell evolution and super-heavy elements as well as sessions devoted to nuclear astrophysics, fundamental physics and new experimental probes. ... The conference fee is ?100. ...

Еще в разделе: (Показать все результаты (>40) - www.msu.dubna.ru/ )

... MI RAN, Alexeyev Conference, 23-28 December . MODERN THEORY OF DYNAMICAL SYSTEMS AND APPLICATIONS TO THEORETICAL CELESTIAL MECHANICS . ... Moscow, December 23-28 . ... SECTION A mostly includes talks in celestial and Hamiltoinian mechanics, symplectic geometry, and some other topics. ... MORNING SESSION 9:30-10:20 . ... BREAK . 12:00-12:50 . SECTION A . ... Special session: SCIENTIFIC LEGACY OF V.M.ALEXEYEV . ... On the works of V.M. Alexeyev in celestial mechanics and dynamical systems. ...

Еще в разделе: (Показать все результаты (>1886) - www.mmonline.ru/ )

• Эволюция Программиста
• MMOnline | Форумы | Разное | Publication/Reference Managers
• MMOnline | Форумы | Аспирантура | Аспирантура в США

О лаборатории . ... Лаборатория теоретической биофизики . ... This small program named TRAX is capable of solving systems of ordinary differential equations and plotting the solution on a phase plane as well as function of time. ... 1 комментарий " Phase plane explorer " . ... OPLS-AA patch for different types of molecules . ... All-atom automatic OPLS-AA topology generator . ... OPLS-AA? in All-atom automatic OPLS-AA topology? ... 2012 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>48) - erg.biophys.msu.ru/ )

• Constructing discrete Laplacian via sparse matrix ERG Research Group:
• Gaussian Cube files loader ERG Research Group: Лаборатория теоретической
• Quantum chemistry information page ERG Research Group: Лаборатория

... Registration and Abstract submission are open for the International Conference on Physics Education ICPE 2014 , that will take place at the Sheraton Cordoba Hotel & Convention Center, C rdoba, Argentina, on August 18th to 22th, 2014. ... Keynote Speaker: Cedric Linder , Professor of Physics Education Research, Division of Physics Education Research, Department of Physics and Astronomy, Uppsala University, Sweden. ... Prof. Zulma Gangoso (Chair) . ... Prof. Zulma Gangoso (Argentina) . ...

Еще в разделе: (Показать все результаты (>109) - foroff.phys.msu.ru/ )

• Faculty of Physics today

IMPALA: Integrating Matrix Profiles And Local Alignments 1. ... Primary preprocessing Prepare the following files : i. a collection of PSI-BLAST-generated profiles with arbitrary names and suffix .chk; ii. a collection of profile master sequences , associated with the profiles , each in a separate file with arbitrary name and a 3 character suffix starting with c; the sequences can have deflines; they need not be sequences in nr or in any other sequence ...

Еще в разделе: (Показать все результаты (>2892) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~julia_p/Practice2/babel.txt
• Help: hgignore
• Help: log

... Scientific conference . ... International recognition of this outstanding woman and scientist serves as a wonderful example for the young people who have chosen chemistry as the basis for the carrier, and makes it possible to commemorate the important contribution of women in the development of chemistry as a science.? ... Especially in Russia women received possibility of professional realization in chemical science and education through? different ways starting from 1870?s on. ...

Еще в разделе: (Показать все результаты (>278) - www.chem.msu.ru/ )