. Bulk of the information is in the Russian version . Go there if you can read Russian . General Information . Personalia . Science and Publications . Uralian Expedition . Crimean Student Practice . Uralian Student Practice . Software , Miscelaneous Informationx . Photoalbums . Address any question to and@geol.msu.ru

Еще в разделе: (Показать все результаты (>17) - sbmg.geol.msu.ru/ )

• Кафедра: главная страница

... As research on Russian classrooms indicates, the instruction in classrooms is usually a one-way process in which the teacher directly presents information and skills dictated by a textbook. Students usually remain passive throughout a lesson. ... One effective method that can be incorporated into the teacher-training program in Russia is cooperative learning. ... One of the benefits of using cooperative learning is increased student communication skills. ... School reform Russian style. ...

Еще в разделе: (Показать все результаты (>127) - www.prof.msu.ru/ )

• Central Eurasian Studies Society Sixth Annual Conference (2005)
• Human Capability and Equity
• Fulbright Academy of Science & Technology's news bulletin

Algorithms for calculating parameters of virtual scenes in computer vision tasks Pavel Samsonov, Andrey Ilyin, Aleksey Ignatenko Department of Computational Mathematics and Cybernetics Moscow State University, Moscow, Russia psamsonov@graphics.cs.msu.ru, ailyin@graphics.cs.msu.ru, aignatenko@graphics.cs.msu.ru Abstract In this paper we describe methods for deter mining the parameters of the camera and the light spot, which due to its properties is similar to a point light. ...

Еще в разделе: (Показать все результаты (>279) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2002.graphicon.Krylov_Korchagin_Lukin.Hermite.en.pdf
• http://imaging.cs.msu.ru/pub/2008.cyprus.yurin_semeikina.plane.en.pdf

... Главная -> Фильмы -> The Browning Version . ... The Browning Version . ... Великобритания 1994 . ... Albert Finney . ... Mark Bolton . ... David Lever . ... Профессор классической литературы привилегированного колледжа для мальчиков, ведущий размеренный консервативный образ жизни (Элберт Финни), разочарован своей карьерой и своим браком. ... И все же профессор находит неожиданную радость в жизни - один из его благодарных и талантливых учеников награждает его сторицей, преподнеся замечательный...

Еще в разделе: (Показать все результаты (>5578) - kinfo.ru/ )

• Reverse of the Curse of the .. - Фильмы - Kinfo.ru
• Pok?mon Gold/Silver Version - Фильмы - Kinfo.ru
• Pok?mon: FireRed Version - Фильмы - Kinfo.ru

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>7) - theorphys.phys.msu.ru/ )

• http://theorphys.phys.msu.ru/education/aqft_slides/ExamSyllabus_Term2.pdf
• Advanced Quantum Field Theory

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>25) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

. Windows CP1251 . Vladimir S. Zakharov . Dr. in geology . Ph.D. in geophysics . Professor . Chair of Dynamic Geology . Geological Department of MSU . Education . Professional experience . Ph.D. thesis . Current research . Electronic versions of posters . Selected publications . Page design: ©V.Zakharov . E-mail: vszakharov@yandex.ru

Еще в разделе: (Показать все результаты (>31) - dynamo.geol.msu.ru/ )

• Publications of V.Zakharov
• V.Zakharov's Ph.D. thesis
• Summaries of articles

... E.V. Kazarovets, N.N . Samus , O.V. Durlevich, S.V. Antipin, M.S. Frolov, N.N . Kireeva, E.N. Pastukhova Institute of Astronomy of Russian Academy of Sciences and Sternberg State Astronomical Institute of ... the Moscow State University ================================================================================ The 74th Special Name-list of Variable Stars , A.V. Kazarovets, N.N . Samus , O.V. Durlevich, S.V. Antipin, M.S.,Frolov, ... 3323 Samus, N.N., IBVS, 1997, No. ...

Еще в разделе: (Показать все результаты (>28) - www.sai.msu.ru/ )

• Absolute proper motions of open clusters

M.H. Shulman, 2011 (shulman@dol.ru) Can the Universe not be a black hole? ... Updated: April 11, 2011) The statement that our Universe is black hole is argued in the paper. ... Particularly, this means that the Universe special volume is not limited, i.e., infinite. ... Geometrical radius R of a (spherical) body is usually much more than RG; however, it is not the case of a black hole, where RG R. Furthermore, let us consider the infinite Universe having a given (average) density and infinite mass. ...

Еще в разделе: (Показать все результаты (>512) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/igamberdiev_physical.pdf
• LOGIC OF CAUSAL MECHANICS: OBSERVATIONS-THEORY-EXPERIMENTS
• QUANTUM-MECHANICAL UNCERTAINTY RELATIONS AS A CONSEQUENCE OF THE POSTULATES OF

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>11584) - mouse.belozersky.msu.ru/ )

• wLake program homepage

... Individual SELEX products, aptamers, are small molecules (40­100 nt) that have a unique three-dimensional structure, which provides for their specific and high-affinity binding to targets varying from low-molecular-weight ligands to proteins. ... Selection of aptamers binding with a target is the key step in SELEX, as aptamers account for only a small fraction of the initial library (one aptamer per 109 to 1013 molecules) [6]. ... Fourth, modification can increase the aptamer affinity for a target. ...

Еще в разделе: (Показать все результаты (>7) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/nar2004.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf

... To save time, I will only provide ephemerides in 2000 coordinates. ... Note: most the orbital elements used to create these ephemerides were obtained from the International Astronomical Union Circulars (IAUCs), Minor Planet Circulars (MPCs) or the ICQ Comet Handbook. ... The following 1-day ephemeris (March 1, 1997 - October 1, 1997) is from Donald Yeomans of JPL and is based on Reference Orbit #55 (March 4, 1997). 2000 coordinates (March - September, 1997) [3/4/97] . ... Epoch: 1997 Feb. 1.0 . ...

Еще в разделе: (Показать все результаты (>20) - www.issp.ac.ru/ )

О лаборатории . ... Лаборатория теоретической биофизики . ... This script allows one to visualize normal modes, calculated with GROMACS package, using PyMol . ... This will produce an object named ?obj-ID?, contaning 20 frames of the system oscillating along selected normal mode. Also the normal modes list is printed once again. ... 1 комментарий " Normal modes visualization for PyMol " . ... I made a modified version for visualizing quasi-harmonic modes. ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>33) - erg.biophys.msu.ru/ )

• Constructing discrete Laplacian via sparse matrix ERG Research Group:
• All-atom automatic OPLS-AA topology generator ERG Research Group: Лаборатория

... Contact information . ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty . ... Our goal is to provide researchers from many branches of science, education and industry with innovative tools and methods for solving applied problems using the latest information technologies, modern methods of computation modeling and scientific visualization. ... The uncertainty can be used in further uncertainty estimation of a computational model that uses FetchClimate. ...

Еще в разделе: (Показать все результаты (>155) - en.cs.msu.ru/ )

• Research Laboratory of Computational Modeling Tools
• Department of Nonlinear Dynamic Systems and Control Processes | CMC MSU
• Department of Nonlinear Dynamic Systems and Control Processes

... Dear book contributors of the NATO ARW, . following the ARW workshop the organizing committee has agreed to the following procedure in order to expedite the process of preparation, distribution and review of the individual manuscripts: . ... The manuscripts received will be sent by Norbert Hertkorn (GSF-Germany) and Irina Perminova (MGU/Russia) for review, typically to two different other authors which also have been participants of the NATO ARW, or to the independent appropriate reviewers. ...

Еще в разделе: (Показать все результаты (>157) - mgumus.chem.msu.ru/ )

• MGUMUS -- Third Conference of CIS IHSS on Humic Innovative Technologies Humic

... Publications . ... Number of publications 0 . ... Publication type . ... Borisov A. V. , Kazakov A. O. , Sataev I. R. The Reversal and Chaotic Attractor in the Nonholonomic Model of Chaplygin?s Top . Regular and Chaotic Dynamics, 2014, vol. 19, no. 6, pp. ... Borisov A. V., Kazakov A. O., Sataev I. R., Regular and Chaotic Attractors in the Nonholonomic Model of Chapygin's ball, Russian Journal of Nonlinear Dynamics, 2014, vol. 10, no. 3, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>144) - ics.org.ru/ )

... Форумы > Аспирантура > Тема . ... PhD position in the University of Florida . PhD position is available in the department of Industrial and Systems Engineering, University of Florida. ... Risk Management and Financial Engineering Lab website: http://www.ise.ufl.edu/rmfe/ . ... Statistical estimation in terms of factor models can be tuned to risk preferences in order to achieve better performance when applied to portfolio optimization. ... University of Florida, November 2011. ...

Еще в разделе: (Показать все результаты (>6463) - www.mmonline.ru/ )

• MMOnline | Форумы | Книжная барахолка | Куплю: Selected topics in
• MMOnline | Форумы | Книжная барахолка | Куплю: в электронном виде Selected
• MMOnline | Форумы | Книжная барахолка | Ищу: Knuth, Donald E. Selected Papers

O.A. Aktsipetrov, E.A. Gan'shina, V.S. Guschin, T.V. Misuryaev, T.V. Murzina. Magneto-induced second harmonic generation and magneto-optical Kerr effect in Co-Cu granular films. ... A.A. Fedyanin, T.V. Misuryaev, T.V. Murzina, and O.A. Aktsipetrov. ... O.A. Aktsipetrov, A.V. Melnikov, T.V. Murzina, A.A. Nikulin, A.N. Rubtsov DC-electric-field-induced optical second harmonic generation at the smooth metal-electrolyte interface // Surf. ...

Еще в разделе: (Показать все результаты (>37) - shg.phys.msu.ru/ )