Sternberg Astronomical Institute, Moscow, Russia . ... After the 2nd World War, the Executive Committee of the International Astronomical Union (IAU) made two groups in Moscow responsible for catalogues of variable stars. ... Presently, the variable-star catalogue groups still exist within the Sternberg Astronomical Institute and the Institute of Astronomy of Russian Academy of Sciences . ... Sergei V. Antipin (Search for new variables, Cepheids, dwarf novae, GCVS) . ... Institute | ...

Еще в разделе: (Показать все результаты (>96) - sai.msu.ru/ )

• Subject: Registration now open for the "European Week of Astronomy and
• Презентация PowerPoint
• Конференции сайта АстрО. J E N A M - 2 0 0 7

... A Proposal for an International Atlas of Lunar Exploration Philip J. Stooke Department of Geography University of Western Ontario London, Ontario, Canada N6A 5C2 Introduction. ... I propose the creation of an International Atlas of Lunar Exploration to tell this story in cartographic form. ... Many new products would be based primarily on spacecraft images rather than drawn maps, which will also reduce costs and help illustrate the primary data products of the principal lunar missions. ...

Еще в разделе: (Показать все результаты (>73) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Symposium/sternber.pdf
• http://selena.sai.msu.ru/Symposium/South%20Pole.doc
• http://selena.sai.msu.ru/Symposium/South%20Pole.pdf

О лаборатории . ... Лаборатория теоретической биофизики . ... Here we provide some instructions that will allow you to make your own visualization using powerful abilities of PyMol. Below you can find step-by-step instruction of how to visualize partial charges or other atomic information. ... Partial charge? All charges will appear near all atoms! ... Нет комментариев " Visualize partial charges in PyMol " . ... Visualize partial charges in PyMol . ... 2014 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>36) - erg.biophys.msu.ru/ )

• Reaction-diffusion systems in 2D space with python ERG Research Group:

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>330) - monkey.belozersky.msu.ru/ )

• Inquiry information || Rule of four sequences

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>255) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: CRISIS IN THEORETICAL PHYSICS: THE PROBLEM OF SCIENTIFIC
• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

... The Conference will be held in Messina, at the University Palace. ... 4 D ead l i n es · Pre-registration Form · Abstracts · Hotel Accommodation Form February 28th, 2009 May 31st, 2009 September 4th, 2009 All correspondence concerning the Conference should be sent to: G. Giardina Physics Department - University of Messina Salita Sperone 31, 98166 Messina , Italy Phone: ++39-090-6765029 or 394602 Fax: ++39-090-395004 e-mail: giardina @nucleo.unime.it 5 International Conference ...

Еще в разделе: (Показать все результаты (>129) - phys.msu.ru/ )

• http://phys.msu.su/upload/iblock/d4d/registration-eng-ru.doc
• http://phys.msu.su/upload/iblock/941/gp2012appform.doc
• http://phys.msu.su/upload/iblock/ac4/firstcircular.pdf

I. S. MAMAEV Institute of computer science 426034, Russia, Izhevsk Universitetskaya St., 1 E-mail: mamaev@rcd.ru NEW CASES WHEN THE INVARIANT MEASURE AND FIRST INTEGRALS EXIST IN THE PROBLEM OF A BODY ROLLING ON A SURFACE Received September 16, 2003 DOI: 10.1070/RD2003v008n03ABEH000249 Some new cases when the invariant measure and an additional first integral exist in the problem of a rigid body rolling on a sphere and on an ellipsoid are discussed in the paper. ... Rolling of a ball on a surface. ...

Еще в разделе: (Показать все результаты (>107) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/c44/129-an-integrability-of-the-problem-on-motion-of-cylinder-and-vortex-in-the-ideal-fluid_ru.pdf
• http://ics.org.ru/upload/iblock/8b0/187-the-dynamics-of-vortex-rings-leapfrogging-choreographies-and-the-stability-problem_ru.pdf
• http://ics.org.ru/upload/iblock/650/122-kinetics-of-collisionless-continuous-medium_ru.pdf

... The traditional answer to this question is unequivocal: тАЬno, public scholarship cannot and should not exist.тАЭ To popularize knowledge is to simplify, and simplification risks the loss of nuance and complexity, the very essence of scholarly knowledge. ... The public sphere can know but a distorted version of scholarly knowledge. ... You need JavaScript enabled to view it. (with Summer School-2016 in the subject line) before April 25, 2016. ... Summer School Archives . ...

Еще в разделе: (Показать все результаты (>18) - discours.philol.msu.ru/ )

... Suppose also that g is continuously differentiable in (0, 1) and g (x) 1 if x (0, 1). Prove that there exists a point t [0, 1] such that f (t) = g (t) = t. 2. ... vn ) the k в n-matrix formed by the coordinates of v1 , . ... Prove that one I can make the matrix A upper-triangular with zeroes at the principal diagonal by finitely many transformations of the following type: one transposes any two lines in the matrix and then transposes the columns with the same numbers. ... Let S AB C be a pyramid. ...

Еще в разделе: (Показать все результаты (>41) - dfgm.math.msu.su/ )

• Intro
• 1st Announcement

... 2015 . ... The article explores the basic approaches to local development management efficiency evaluation through consideration of an estimation of efficiency social and economic development of municipal union and a local development management efficiency evaluation. ... Efficiency, local development, evaluation. ... No material published in this journal may be reproduced in print or in electronic form without a link to "E-journal. Public Administrarion". ... Copyright ї 2015 SPA MSU . ...

Еще в разделе: (Показать все результаты (>116) - ee-journal.spa.msu.ru/ )

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

referer = getenv( HTTP_REFERER ); if (!(preg_match( /genphys.phys.msu./ , $referer) || preg_match( / mikromag / , $referer))) { echo hacker? he-he...\n ; exit ; }//if require_once($ GLOBALS [ DOCUMENT_ROOT ]. / mikromag /script/config.php3 ); ////////////////////////////////begin///////////////// class cl_registraciya { var $fd, $ action , $password, $ login ; //*************************** function ... Ваш login ".$this->fd["login"]." ...

Еще в разделе: (Показать все результаты (>40) - genphys.phys.msu.su/ )

• Микромаг - сервер
• Active To Do List
• To Do List History

МГУ имени М.В.Ломоносова Русская версия . ... Science calendar . ... About Conference . ... Asian and African Studies . ... Art Criticism and History . History and Art History . ... International Conference for Students and Young Scientists "Lomonosov" . ... 29 Feb 2016 . ... The History and Art History section will convene 11 branches of historical studies and the round table: . ... Historical Information Science (Digital History) . ... Art History . ... МГУ имени М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>11451) - conf.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>15) - lab110.imec.msu.ru/ )

International Laser Center of MSU . ... Education . ... Laser Graduate School . ... Home Education Continuing Education and Retraining Program . The International Laser Center of Moscow State University accepts visiting scholars from all over the world for training programs in laser physics and technologies. The ILC offers the following continuing education and retraining programs in these fields: . ... International Retraining and Post-docs Program; . Laser Graduate School short courses . ...

Еще в разделе: (Показать все результаты (>682) - ilc.phys.msu.ru/ )

Address . ... Phone: (495) 939-5424 . Fax: (495) 938-2136 . ... 939-1734 . Scientific Information Department . 939-1822 . ... Database Structure and Maintainance (in Russian) . ... Information Systems (in Russian) . ... Information Modelling (in Russian) . ... Computational Systems and Applied Programming Technologies (in Russian) . ... Parallel information Technologies (in Russian) . ... Mobile and Computing Systems (in Russian) . ... Informations Systems for Mathematics (in Russian) . ...

Еще в разделе: (Показать все результаты (>78) - srcc.msu.ru/ )

• Leading scientific fellow Sergey Piskarev Ph.D.
• Laboratory of Systems for Automated Image Processing
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial

... Electronic journal Issue 4. 10 september 2004 Vorontchuk, Cox III R.W. Developing a Competency-based Career Training and Professional Development Program for Latvia INTRODUCTION. ... With the support of a grant from the NISPAcee a team from the Latvian School of Public Administration, the University of Latvia and the University of Akron (Ohio, USA) prepared for the Chancellery of Latvia a proposal for the creation of a career-long professional development program for those in the civil service. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

General Information . ... The conference is organized by the Sternberg Astronomical Institute (SAI) of Moscow University and the IAU Working group "Site-testing Instruments" . ... Use of site data in telescope operation and adaptive optics. ... Recent conferences on this subject (2007, 2008) demonstrated great interest of the community, hence the need for a new meeting. ... Unlike previous recent conferences, this meeting will cover all aspects of site monitoring for optical/IR astronomy. ...

Еще в разделе: (Показать все результаты (>24) - site2010.sai.msu.ru/ )

• Registration is prolonged
• Registration is prolonged again
• The registration is closed

IMAGE INTERPOLATION WITH AUTOMATIC HINTING BASED ON GRADIENT SPARSITY Alexey Lukin Laboratory of mathematical methods of image processing, Dept. of Computation Mathematics and Cybernetics, Lomonosov Moscow State University, Russia 1. Introduction Many algorithms exist for image interpolation: linear filtering methods (such as bilinear, bicubic or Lanczos filters), nonlinear edge-adaptive methods, and a super-resolution method. ...

Еще в разделе: (Показать все результаты (>469) - imaging.cmc.msu.ru/ )

• View publication | Laboratory of Mathematical Methods of Image Processing
• Image sharpening by grid warping | Laboratory of Mathematical Methods of Image
• Laboratory of Mathematical Methods of Image Processing