... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Master Education . ... Master programs . ... Master program "Mathematical Models of Complex Systems: Theory, Algorithms, Applications" . ... The Mathematical Models of Complex Systems: Theory, Algorithms and Applications Master?s programme is aimed at studying the foundations of computational methods and software for new types of current problems in modelling, decision-making, and control of complex systems. ... Второе высшее образование: second_edu@cs.msu.ru, 6-й этаж, комната 640, тел. ...

Еще в разделе: (Показать все результаты (>149) - hcs.cmc.msu.ru/ )

• Master program "Open Information Systems" | Магистерское и послевузовское
• Master program "Network Software" | Магистерское и послевузовское образование
• User account | Магистерское и послевузовское образование

... Executive MBA programs have kept their popularity among high-ranking businesspeople in Russia, despite the economic crisis. ... The Chicago School of Business created the first EMBA program in 1943, and more than 300 programs now exist worldwide, according to the Executive MBA Council, an international business education association. ... Even when the EMBA program uses the same business cases as the MBA offering, Boltrukevich said, the education s different because the group of students is different...

Еще в разделе: (Показать все результаты (>1452) - www.mgubs.ru/ )

• Moscow Times о российских программах Executive MBA

Judging the pedogenic development of soils and paleosols seems simple until more than three kinds of soils are considered. ... SD is commonly described as weak, moderate or strong (or poor, moderate or well), a 3-class system that can be modified with adjectives. ... A scale for ranking soil and paleosol development. ... An effective paleosol classification requires delineation of those key attributes in modern soils with a moderate to high preservation potential following burial and diagenesis. ...

Еще в разделе: (Показать все результаты (>171) - www.fadr.msu.ru/ )

• PALEOPEDOLOGY COMMISSION FOR INTERNATIONAL UNION OF SOIL SCIENCE (IUSS)...
• The Period 1995 - 1999 of the Paleopedology Commission
• Created with DiDa

... What is the author's opinion on the problem? ... Organize the following parameters into 3 groups: content, organization, presentation (performance) · Body-language and eye contact · Fluency · Proper intonation and pronunciation · Relevant information and examples provided · Conclusion · Key concepts explained\defined · A range of complex grammatical structures and academic vocabulary · Key points emphasized · Introduction · Various linking devices, the transition from one point to the ...

Еще в разделе: (Показать все результаты (>23) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/theses3.pdf
• http://www.eng.math.msu.su/download/Model_rendering_scheme_and_connectives.pdf
• http://www.eng.math.msu.su/download/The_Day_The_World_Changed_article_and_vocabulary.pdf

FAQ: QUESTIONS ASKED BY NOVICE USERS (c) Australian Geological Survey Organisation 1999-2002 (c) Yuri Shvarov 1999-2002 Last updated: 3 May 2002 This file does not substitute for the comprehensive HCh documentation. ... 2 UNITHERM USAGE 2.1 UNITHERM DATABASE 2.1.1 What is the guaranty that the included UNITHERM database has no incorrect entries? ... User's Guide. ... You can speed up your calculations for aqueous systems in a "manual" calculation mode of GIBBS when using Blank or Input files. ...

Еще в разделе: (Показать все результаты (>90) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/geochems/soft/en/Ab_An.doc
• http://www.geol.msu.ru/deps/geochems/soft/en/Electrum.doc
• http://www.geol.msu.ru/deps/geochems/soft/en/ZnS_FeS.doc

... Davis Center for Russian Studies at Harvard University. The Center aims at developing of fundamental knowledge about Russia, its culture, and its institutions. The Center also examines Russia in its regional and historical context, and welcomes and supports the study of neighboring countries that have been either integrated with, or subordinated to, the Russian state at various periods in history, or whose experience poses intellectual problems similar to those of Russia. ...

Еще в разделе: (Показать все результаты (>35) - suny.msu.ru/ )

... School problem is extremely important. ... Our President has mentioned the territorial disparity, i.e. two-thirds of our schools are the rural schools and their graduates are at unequal terms with their equals from cities' schools to get following education. ... Create special conditions in education for disabled children, for orphans and children from unfortunate families, pupils from rural schools and gifted children. ... Ensure social equity for all children during school education and after it. ...

Еще в разделе: (Показать все результаты (>35) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/395.doc
• http://www.rsr-online.ru/doc/norm/396.doc
• http://www.rsr-online.ru/doc/norm/111.doc

... At the end of 2009 a financial crisis began to develop in Greece, by May 2010 spreading over the whole euro area. ... The article examines the internal problems of Greek economy, which caused the loss of confidence in the country and, as a consequence, a deep financial and economic crisis. ... Global financial and economic crisis, European Union, economy of Greece, budget deficit, public debt. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>299) - ee-journal.spa.msu.ru/ )

... News . ... Lost Username Lost Password . If you lost your username , please enter your E-mail Address, then click the Send Username button, and your username will be sent to your email address. If you forgot both your username and your password , please recover the username first, then the password. ... If you lost your password but know your username, please enter your Username and your E-mail Address, press the Send Password button, and you will receive a new password shortly. ...

Еще в разделе: (Показать все результаты (>76) - engineering.phys.msu.ru/ )

• Jumping Robot
• Parallel Programming
• Introduction to Linux

Prague, August 16, 2006 . Our trial revision of the GCVS data for several southern constellations show that type changes are not needed for most stars. ... We suggest to add one more symbol combining types, in the cases when two or more classification options remain for the same star, for example, EC|Ell, EC|RR (here EC means a contact eclipsing binary, this is one of our suggestions from next slides). ... Moreover, it will simplify moving stars from the suspected-variable catalogue to the GCVS. ...

Еще в разделе: (Показать все результаты (>112) - sai.msu.ru/ )

From: Andrey Deriabin Date: 24 Jan 97 To: SOCREP-L@taunivm.tau.ac.il Subject: Soc. Representations & Soc. Constructionism It seems obvious that there are many common things between "social constructionism" and social representations theory. But Gergen and others seem don't refer to Moscovici (an exception is 'Discourse & Social Psychology' by Potter) and I haven't met references on soc. constructionism in soc.rep's texts.[ ... Ken Gergen ...

Еще в разделе: (Показать все результаты (>14) - psyberlink.flogiston.ru/ )

Wedging of an Elastic Medium with the Formation of Separation Zones / Zvyagin A.V., Romashov G.A. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>225) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika

Home People Activities Research Publications . Yurin's home page . ... Юрин Д.В. "Расчетно-параметрическое исследование флуктуаций сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // Автореферат диссертации на соискание ученой степени кандидата физико-математических наук (специальность 01.04.03-радиофизика). ... Юрин Д.В. "Метод расчета статистических характеристик сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // В кн. ...

Еще в разделе: (Показать все результаты (>19) - imaging.cs.msu.ru/ )

Sergey A. Ayvazyan Methods of Econometrics Introduction Dear reader, You have a textbook in your hands on methods of econometrics, one of the three basic disciplines of higher economic learning, along with micro- and macroeconomics. In Russia, unfortunately, the status of econometrics was recognized belatedly: econometrics was introduced into the study programs of economic learning in several leading Russian higher educational institutions only since 1992. ...

Еще в разделе: (Показать все результаты (>24) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipelov_comment_on_reserve.pdf
• http://www.mse-msu.ru/Russia_2010_MSE_en.pdf
• http://www.mse-msu.ru/Nekipelov_France_2010_Text_Eng.pdf

... О межфакультетских курсах МГУ . Видео МФК . ... Канал МГУ на YouTube . ... Комментарии Дата Просмотры Лайки Комментарии Упорядочить по возрастанию . ... x25BA; Кинофонд МГУ (95) . ... x25BA; Фильмы о МГУ (5) . ... x25BA; СУНЦ МГУ (5) . ... x25BA; МФК (1084) . ... x25BA; Механико-математический факультет (5) . ... x25BA; Социологический факультет (13) . ... x25BA; Факультет журналистики (11) . ... x25BA; Факультет наук о материалах (7) . ... Copyright 2016 ї Видеоархив МГУ имени М.В.Ломоносова . ...

Еще в разделе: (Показать все результаты (>175) - media.msu.ru/ )

• Университетские субботы (МГУ-школе) | Видеоархив МГУ имени М.В.Ломоносова

. Jump to Navigation . Chair of Computer Methods of Physics . Department of Physics, M.V. Lomonosov Moscow State University . Create new account . Log in . Request new password (active tab) . Username or e-mail address * CAPTCHA . This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Main . Contacts . Department of Physics M.V. Lomonosov Moscow State University , Chair of Computer Methods of Physics , 2014 . Found an error? Let us know ! . Login .

Еще в разделе: (Показать все результаты (>5) - cmp.phys.msu.ru/ )

... The haloid compounds with perovskite-like structure undergo as a rule ferroelastic phase transitions (PT's) related to the soft modes of lattice vibrations. ... The analysis of the relationship between the susceptibility to external pressure at PT's from initial phase and the structural peculiarities has been carried out for some families of perovskite-like ferroelastics, namely: perovskites, elpasolites, antifluorites, compounds with the ordered ReO 3 structure and layered perovskites. ...

Еще в разделе: (Показать все результаты (>79) - scon155.phys.msu.su/ )

• Direct determination of the shape of potential well for off-center Ge atom in

SEISMIC DATA INTERPRETATIO N Graduate program "Applied Tectonics and Dynamic&Structural Geology" is intended for advanced studies in the classical chapters of Tectonics TECTONICS AND GEOLOGICAL and used to solve applied geological problems. All major areas, such as ANALYSIS FOR EXPLORATION Tectonics, Structural Geology, Geological Interpretation of the Geophysical Data and practical approaches for applied geological analysis, are covered by this graduate program. ...

Еще в разделе: (Показать все результаты (>26) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/personal/vsz/posters/nlob/nlob2.html

... On behalf of the hosting geochemical community from the Institute of Volcanology and Seismology and Russian Academy of Sciences (RAS) we are happy to invite the international geochemical scientific group working on volcanic gases to participate in the 2011 Gas Workshop to be held in Kamchatka, Russia, between 1 st and 10 th September 2011. ... Measurements of soil degassing at Mutnovsky geothermal field 11th Gas Workshop, Kamchatka, Russia CCVG-IAVCEI . ... IAVCEI Organizing Committee . ... IAVCEI ....

Еще в разделе: (Показать все результаты (>459) - geo.web.ru/ )

• Minarik: Earth Core Studies
• COMAGMAT MODEL
• Problems of South Ural Quaternary Geology