Astronomy Picture of the Day . ... 16.02.1996 . ... Credit: F. Summers ( Princeton ), D. Cox, R. Patterson, E. Wesselak, and B. Sanders ( NCSA ), L. Carpenter ( Pixar ), GC3 , Cosmic Voyage , Smithsonian Explanation: What did our universe look like when it was young? ... The above animated frame is the result of such a calculation and shows how our universe might have looked when it was just a fracton of its current age . ... February . ... NASA Web Site Statements, Warnings, and Disclaimers . ...
Russian abstract] . Russian full text] . The classifications revealed by geometric morphometry and classical morphometry for Drosera rotundifolia , D. obovata , D. anglica and D. linearis were compared. ... the form of petiole middle part transverse section is the effective distinguishing character for the some different species and inter-species hybrids of Drosera ; . the consensus configurations are preferable for the geometric morphometry analysis of populations. ...
S .. ... a database of structures of DNA-protein and RNA-protein complexes. ... a program for finding hydrophobic clusters in 3D structures of macromolecules . ... search of conserved hydrophobic clusters in aligned 3D structures of protein families . ... a program for analysis of multiple alignments . ... a program for automatic detection of aligned blocks in a multiple protein alignment. ... a program for detection of aligned blocks in a multiple alignment of sequences of PDB chains. ...
hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . ... Регистрация . ... Серия Blue Gene в мире . ... Доступ по SSH . ... Регламент доступа . ... С 2008 года на факультете ВМК МГУ имени М. В. Ломоносова работает суперкомпьютер IBM Blue Gene/P, который является одной из первых систем данной серии среди установленных в мире. Архитектура Blue Gene была предложена компанией IBM в рамках проекта по исследованию возможностей достижения новых рубежей в супервычислениях. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... О кафедре . English . ... Department for Jewish Studies of Lomonosov Moscow State University . ... The Department for Jewish Studies (DJS) was established in 1998. ... The students take courses offered by the School (the Institute of Asian and African Studies), as well as courses offered by the Jewish Studies Department. ... The Department regularly accepts university teachers of Jewish and Israeli Studies from Russia and the FSU in order to upgrade their professional level. ...
pic] Program of humanitarian aid from Russia Rectors' Union (RRU) to South-Ossetia's Tibilov State University The first batch of humanitarian aid from RRU to South-Ossetia's Tibilov State University was dispatched to Vladikavkaz by Ministry of Emergencies' charter plane at August 27. It included 1612 classical textbooks and manuals, and a modern computer training-room, comprised of 34 units of equipment. ... September 16, another charter plane has delivered the second batch of humanitarian aid. ...
... High-Contrast Pulse-Echo Ultrasonic Imaging with Post-Beamforming Nonlinear Filters . ... We introduce a system-identification post-beamfroming nonlinear filter approach to pulse-echo ultrasonic imaging. ... It is shown that the system identification approach to nonlinear ultrasonic imaging is robust and can be applied to form nonlinear echo images throughout the imaging field, i.e., not confined to the ROI where the filter coefficients were computed. ...
... О факультете . ... Лекторий МГУ . ... Новости ФББ . Новости МГУ . ... Лекторий МГУ: 19 апреля, Ольга Александровна Филатова . 2016 . ... Программа секции "Биоинженерия и биоинформатика" . ... Олимпиада ФББ МГУ . ... Факультет биоинженерии и биоинформатики был создан на базе НИИ ФХБ им.А.Н.Белозерского МГУ в 2002 году. ... Факультет биоинженерии и биоинформатики, комната 433. ... 2016 Факультет биоинженерии и биоинформатики . Московского Государственного Университета имени М.В.Ломоносова . ...
... Department of Vertebrate Zoology . Department of Vertebrate Zoology is one of the oldest departments of the Biological Faculty of Lomonosov Moscow State University. ... The students improve their practical skills in the courses of Microtechniques, Computer Methods in Biology and Methods of Field Research. ... The Department includes five research laboratories. ... Laboratory of Vertebrate Behaviour conducts research on the development of behavioural interactions in the higher vertebrates. ...
... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...
... Faculty of Physics . ... Divisions Chairs . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...
... Key words: Mathematical physics, algebraic geometry, quantum groups. ... Major research position at the Higher geometry and topology department of MSU(from 2009) Doctor habilitatus degree in physical-mathematical sciences Адрес: 119991 ГСП-1, г. Москва, Ленинские горы, МГУ, механико-математический факультет, кафедра высшей геометрии и топологии e-mail: dtalalaev@yandex.ru тел: (495) 939 3798 Текущие научные проекты: Семинар по некоммутативной геометрии (ИТЭФ). ... Семинар ИТЭФ . Семинар МГУ . ...
GENERAL INFORMATION . Administration . Organization Division . Information Division . ... Scientific Council D 053.05.76 . The Prof. Ilya Berezin Foundation . Postgraduate Students . Students . ... Scientific Subdivisions | ... 1998-1999 Chemical Enzymology Department, Chemistry Faculty . ... Back . ...
BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...
... Foundation of Physics Group University of Bari (headed by Professor Augusto Garuccio, garuccio@fisica.uniba.it), Department of Physics, Bari, Italy; . ... University of Geneva, Group of Applied Physics, Division of Optics (headed by Professor Nicolas Gisin, Nicolas.Gisin@physics.unige.ch). Joint INTAS project; . ... National University of Singapore, Faculty of Science, Department of Physics (headed by Professor C. Oh) and Laboratory of Quantum Information (headed by Professor Arthur Ekert). ...
T he student body is the central group of the Faculty of Physics. ... The Faculty offers its students the widest choice of training programmes and majoring opportunities. ... C urrently there are about 40 general courses and over 650 specialized courses delivered covering a wide range of traditional and new areas of physics research. ... F rom the first year students can be trained under two programs physics or astronomy. ... T here is a specific education system in place at the Faculty of Physics. ...
... The teaching aids were founded as a result of the collaboration between the historical information science laboratory, and the source studies department, Lomonosov Moscow State University, and the department of economic history and information technology of the history faculty, Ogareva Mordovskii State University. ... The teaching aids are not specifically oriented towards students and historians, but also to all interested in the application of statistical methods in historical research. ...