... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... Geography of World Economy . ... This led to the need to study the spatial organization of the world economy, geopolitics, the geography of international economic relations, regional integration of states and other relevant topics. ... Elena N. Samburova, PhD (Geography): geographical Sinology; the geography of international economic relations; position of Russia in the world economy; . ... Introduction into the Geography of World Economy: International Division of Labor (in Russian) . ...
. Выше: curs Пред.: Литература Содержание . This document was generated using the LaTeX 2 HTML translator Version 2002-2-1 (1.70) . Copyright ї 1993, 1994, 1995, 1996, Nikos Drakos , Computer Based Learning Unit, University of Leeds. Copyright ї 1997, 1998, 1999, Ross Moore , Mathematics Department, Macquarie University, Sydney. The command line arguments were: . latex2html -white -local_icons curs . The translation was initiated by Sergey E. Koposov on 2005-02-12 . Sergey E. Koposov 2005-02-12
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...
. Links . arXiv.org (Lanl gov) . Large amount of articles . http://arXiv.org . Scientific Electronic Library . http://www.elibrary.ru . Elsevier Science; Kluwer Academic Publishers; Springer Berlin Heidelberg . and others... Laboratory of Theoretical Nonlinear Dynamics in Institute of Radio-Engineering and Electronics of RAS, Saratov Branch IRE RAS . http://www.sgtnd.tserv.ru . Head of the group Doctor of Sciences, Professor Sergey P. Kuznetsov . Painter Andrey Isaev . http://www.IsaevArt.ru .
... About choir . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Bishop Tikhon opened the choir of Moscow State University in Vienna . Choir of Moscow State University spoke at the Vienna branch of the United Nations . ... Oldest amateur choir in Russia . Moscow state university Academic choirљ . ... Any questionsљby phone:љ+7 (495) 939-1862, +7 (495) 939-3563 . ...
old_news ]] . CompHEP . Trace: old_news . 25/05/2004 CompHEP version 4.4.3 is released БЂ¦б» More . 16/11/2003 CompHEP version 4.4.0 is released БЂ¦б» More . 01/11/2003 CompHEP version 4.2.1 that support old format of events is released. ... Community contributions . Community model library . ... CompHEP team . License . ... Installation guide . MAC OS installation . CompHEP-3.3 Manual . CompHEP-3.3 Manual (pdf) . ... CompHEP on the Web . ... CompHEP at LHC . ...
... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...
... The haloid compounds with perovskite-like structure undergo as a rule ferroelastic phase transitions (PT's) related to the soft modes of lattice vibrations. ... The analysis of the relationship between the susceptibility to external pressure at PT's from initial phase and the structural peculiarities has been carried out for some families of perovskite-like ferroelastics, namely: perovskites, elpasolites, antifluorites, compounds with the ordered ReO 3 structure and layered perovskites. ...
Lomonosov Moscow State University, Faculty of Mechanics and Mathematics, English Department On Borsuk's problem by A. Lukina, group 305, English teacher: A.A.Savchenko 1. ... It studies combinatorial properties of finite or discrete bodies or bodies with some particular characteristics, for instance, of a certain diameter. ... A number of questions arise from this problem. ... It is useful to deal with not just a body of diameter one, but with its approximation, called universal cover system. ...
... You represent the Union of Rectors uniting the principals of almost all higher educational institutions of the country, and this association has well-deserved recognition. ... From V. Putin's speech at the meeting with the Russian Union of Rectors, Moscow, August 24, 2011. ... At the X Congress of the Russian Union of Rectors the President of RUR V.A. Sadovnichy suggested the creation of interactive inter-university scientific and educational project "University Department" . ...
ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
О лаборатории . ... Лаборатория теоретической биофизики . ... Here orig1 is the starting value of internal coordinate and zero corresponds to this value in current geometry. disp1 means step of scanning (degrees for angles and Angstroms for bonds). ndisp1 points number of steps in PES scan. vect1 ? ... Нет комментариев " Scanning PES ab initio and in MM " . ... OPLS-AA patch for different types of molecules . ... Scanning PES ab initio and in MM . ... 2015 ERG Research Group . ...
... Conferences . ... International Scientific Conference "Probability Theory and its Applications" on Occasion of the 85-th Birthday of Yu.V.Prokhorov is organized by the Steklov Mathematical Institute , Faculty of Computational Mathematics and Cybernetics of Moscow State University , and Institute for Informatics Problems of Russian Academy of Sciences from 12 to 14 of February, 2015. ... CMC MSU students at GSIS Summer School, Tohoku University, Japan . ... CMC MSU тИТ GSIS Tohoku IT Joint Seminar . ...
... Improvement of Java type compiler using in language independent remote process calls in KBase project. 09/2011 present: Moscow State University, Dept. of Bioengineering and Bioinformatics (Russia) Scientific Research Java developer and lecturer Enhanced the CAMPS web resource (http://webclu.bio.wzw.tum.de/CAMPS2.0/) that enables multiple classification of transmembrane proteins. ... Developed web based UI for visualization of a graph of transmembrane protein families. ... Sutormin RA, Mironov AA. ...
[
Текст
]
Ссылки http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2013.pdf -- 202.5 Кб -- 26.08.2013 Похожие документы
Core information (Nucleus, Levels, Gamma transition, Decays, Data type) . ... any adopted (levels and gammas only) experimental . ... Query parameters: . Select for output . ... Levels (E, JPI, T1/2, etc.) ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . Relative photon intensity . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ...