Web-service MTPro is designed for defining DNA methyltransferase domain (from RM system)class by specifically made profile search. The class describes a combination of the most common DNA methyltransferase characteristics: methylated atom, motif group, and probable type of RM system. The output format and result definitions see here . Protein sequences of one or more DNA methyltransferases in fasta format is a required information. E-value cutoff . ... Programming: Anna Popenko . ...

Еще в разделе: (Показать все результаты (>7252) - mouse.belozersky.msu.ru/ )

• wLake program homepage
• wLake algorithm description

... Вакансии . ... Commitment: the dedication to achieve your goals - and to continuous professional and personal development . ... HP Graduate Development Program: Our new 18 month Graduate Development Program has been designed to get the most out of the best graduates by giving you the opportunity to gain experience and exposure across HP's businesses. ... HP gives you the opportunity to transition from a brand new graduate to a professional in Sales, Information Technology, Consulting and Marketing. ...

Еще в разделе: (Показать все результаты (>120) - www.physcareer.ru/ )

Maria Davidich Personal Homepage . Scientific research . Biography . ... Since 2001-2003 I was working in the laboratory, Chair “Polymers and Crystals”, and my research was concerned with swelling behavior of polymer networks, polymer physics, high elasticity an swelling behavior of polymer networks, hydrophobically modified polyelectrolyte gels, type of research-experimental (list courses of the chair “Polymers and crystals” could be found here) . ...

Еще в разделе: (Показать все результаты (>150) - polly.phys.msu.ru/ )

• Main - Chair of Polymer and Crystal Physics
• List of Publucations

Lomonosov project . ... Scientific goals . ... Gamma-bursts . ... Scientific equipment . ... BDRG . ... ShOK . ... Information unit (BI) . ... Three complexes of scientific equipment onboard ?Lomonosov? satellite will provide multi-wave measurements of gamma-bursts , which are necessary for the studies of the nature of these astrophysical sources. These complexes are BDRG, ShOK and UFFO providing gamma-bursts? measurements within optics, gamma, X-ray and UV-ranges of electromagnetic spectrum. ...

Еще в разделе: (Показать все результаты (>59) - lomonosov.sinp.msu.ru/ )

• IMISS-1 | Университетский спутник "Ломоносов"
• DEPRON | Университетский спутник "Ломоносов"
• ELFIN-L | Университетский спутник "Ломоносов"

SPAW Editor PHP Edition version 1.0.6 Release Notes Thanks to everyone who downloaded, tried and supported SPAW Editor! This release includes several new features: css classes for tables, background images in tables and table cells, improved link dialog and more. ... If you are fluent in any of languages that are now included and see any typos or mistakes please report to spaw@solmetra.com Happy editing, Alan Mendelevich a.k.a. ailon alan@solmetra.com ...

Еще в разделе: (Показать все результаты (>82) - textbook.sinp.msu.ru/ )

• Index of /modules/ax_content/atomax/spaw

... О UNИX . ... Неизменяемая страница . ... Другие действия: Показать разметку Вид для печати Сформатировать как Docbook Очистить кэш страницы ------------------------ Проверить правописание Похожие страницы Карта окрестностей ------------------------ Переименовать страницу Удалить страницу ------------------------ Подписать пользователя ------------------------ Очистить от спама Вернуть эту версию Страницы пакета Синхронизировать страницы ------------------------ ... docinfo.html . ...

Еще в разделе: (Показать все результаты (>1215) - uneex.mithril.cs.msu.su/ )

• Index of /static/AltDocs_xterm_class
• Index of /static/AltDocs_informatika1/Book1/6_dhtml/3_2_1_css/2_class
• HelpOnInstalling/ApacheOnWin32withDomainAuthentication - UNИX

... We show that boundary gauge fields are crucial for the consistent and complete definition of the theory. The result is important for the theory of high energy QCD evolution, since scattering amplitudes are directly related to the lightcone Hamiltonian, whose complete structure is still unclear on quantum level. Namely, there exists the problem to construct a quantum algebra of observables in lightcone QCD beyond the perturbative regime. ... 4 2 How to quantize lightcone QCD? ...

Еще в разделе: (Показать все результаты (>136) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2013/QFTHEP-Golovnev.pdf
• http://qfthep.sinp.msu.ru/talks/Slavnov.pdf
• http://qfthep.sinp.msu.ru/talks2013/Exponen_decay_HEP_2013.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>30) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out

... CC Large Hall, Chair G. Passarino . ... P. Shawhan, LIGO Data Analysis (ID=522) 30 min . D. Buskulic, Data Analysis Software Tools used during VIRGO Engineering Runs, review and future needs (ID=504) 30 min Plenary Session, 11:30 - 13:30 . ... J. Moscicki, A Component Framework for Distributed Parallel Data Analysis in HEP (ID=306) 25 min Parallel Session, 15:00 - 16:50 . ... A. Soloviev, Application of Wavelet Analysis for Data Treatment of Small-Angle Neutron Scattering. ID=269) 20 min . ...

Еще в разделе: (Показать все результаты (>70) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/ososkov/ACATOsoskov.doc
• http://acat02.sinp.msu.ru/poster-sessions.html
• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-08-Information1.pdf

Starting Apache on Windows . Starting Apache on Unix . ... If the Port specified in the configuration file is the default of 80 (or any other port below 1024), then it is necessary to have root privileges in order to start Apache, so that it can bind to this privileged port. ... As an alternative to invoking the httpd binary directly, a shell script called apachectl is provided which can be used to control the daemon process with simple commands such as apachectl start and apachectl stop . ...

Еще в разделе: (Показать все результаты (>100) - neptun.sai.msu.ru/ )

• MS Windows Netscape 3.0b4 KeepAlive problem solved
• Apache Tutorial: Dynamic Content with CGI
• Descriptors and Apache

SEISMIC DATA INTERPRETATIO N Graduate program "Applied Tectonics and Dynamic&Structural Geology" is intended for advanced studies in the classical chapters of Tectonics TECTONICS AND GEOLOGICAL and used to solve applied geological problems. All major areas, such as ANALYSIS FOR EXPLORATION Tectonics, Structural Geology, Geological Interpretation of the Geophysical Data and practical approaches for applied geological analysis, are covered by this graduate program. ...

Еще в разделе: (Показать все результаты (>24) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/Crimea/win_right~eng.html

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>24) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Relational ENSDF

. Please standby and you will be automatically connected to the new location of the unframed Supernova page. Or, click on the link above. If you have questions or problems, please email me at David Bishop dbishop@vhdl.org . Last modified: Mon Aug 27 12:40:15 EDT 2001

Еще в разделе: (Показать все результаты (>16) - www.rochesterastronomy.org/ )

• Supernova 1999an in IC 755

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>31) - erg.biophys.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>6) - lab110.imec.msu.ru/ )

... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>3) - www.imec.msu.ru/ )

• EUROMECH Colloquium-458

... This article is devoted to the problems of education policy in the Russian Federation in the 1990 s. Relying on the wide range of literature and other sources the author considers the most important directions of the state government analyzing positive and negative consequences and contradictory trends of the education policy in 1990 s. In the article the author points out that in the education system there was no common opinion about the perspectives and lines of development. ...

Еще в разделе: (Показать все результаты (>297) - ee-journal.spa.msu.ru/ )

... Вниманию аспирантов! ... Вниманию аспирантов (группа проф. Хмелевской С.А.)! Семинар по истории и философии науки 30 марта отменяется. ... Вниманию аспирантов первого года обучения! ... Лекции по истории и философии науки будут читать проф. Яковлев В.А. по пятницам в 12:30, ауд. 5-18 (первое занятие 18 марта) и проф. Волкогонова О.Д. по понедельникам в 15:20, СФА (первое занятие 14 марта). ... Семинары по истории и философии науки будут проходить по вторникам в 17:00, ауд. ... Вниманию аспрантов! ...

Еще в разделе: (Показать все результаты (>2) - aspirant.phys.msu.ru/ )

... Полная версия этой страницы: Продам велик Merida Matts Sport 500 . Студенческий форум Физфака МГУ > Общий > Все обо всем > Объявления . ... BR> <BR>(цвет только не такой; на фотку моего велика можно глянуть тут )<BR><BR> . ... tbody><tr bgcolor="#d7d7d7"><td nowrap="nowrap" valign="top"><b class="tech">РАМА:</b></td><td valign="top">MERIDA, MATTS SPORT DISC FRAME</td></tr> . ... Merida Matts Comp или Merida Matts Mission (Disk) (или даже GT Avalanche 0.5). ...

Еще в разделе: (Показать все результаты (>506) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > DjVu problem
• Студенческий форум Физфака МГУ > Физпрак
• DjVu problem - Студенческий форум Физфака МГУ

... The Second International Astronomy Olympiad . ... Problems to solve, 8-10 Form Text of these problems is available in Russian too. ... Two stars have the same absolute magnitude. ... The orbital period of Mars is 687 days. ... See problem 2. for 8-10 Form. ... Problem to solve, 9-12 Form Text of the problem is available in Russian too. ... Problem is about Doppler-effect, to find velosities of two stars using their spectra and spectrum of our Sun, to estimate speed of the Earth moving around the Sun...

Еще в разделе: (Показать все результаты (>21) - www.issp.ac.ru/ )

• IO of EAAS, Problems to solve (In Russian)
• II IO of EAAS, Problems to solve (In Russian)
• Gavrilov M.G. "Zviozdnyj Mir" (in Russian), problems 339-344