. Published since 1829 . Editor in Chief: A.S. Severtsov . Editorial Board :V.N. Pavlov (Assistant Editor), Yu.A. Dubrovsky, F.Ya. Dzerzhinsky, R.D. Zhantiev, V.G. Krivenko, M.V. Mina, E.N. Mirzoyan, O. P.Poltaruha, D.D.Sokoloff, V.G. Onipchenko, A.V. Sviridov, G.N. Simkin, M.V. Nilova (Secretary), P.S. Tomkovich.

Еще в разделе: (Показать все результаты (>192) - herba.msu.ru/ )

• Создание баз данных по флоре островов и озер Северной Карелии

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

Supernova 2001dr in NGC 4932 . This page is devoted to information on Supernova 2001dr in NGC 4932 Basic information on this SN, including the last reported brightness, on this Supernova can be found on the main page . Information on the original web pages for many of these images can be found on the updates and links web pages. ... Web pages dedicated to this SN. AUDE has a 2001dr page in French [ Translate ] . ... Image Credit . ... 2001/08/14.88 . ... VSNET Light curve (requires JAVA). ...

Еще в разделе: (Показать все результаты (>117) - www.rochesterastronomy.org/ )

• Supernova 1998eg in UGC 12133
• Supernova 2001V in NGC 3987
• Bright Supernovae pages - Updates 1998

... Custom Query . ... Component . ... automata io requirements ui . ... В And В Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . Or В Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . ... Summary Component Milestone Status Owner Type Priority Resolution Created Modified Blocked By Blocking Reporter Keywords Cc . ...

Еще в разделе: (Показать все результаты (>691) - kodomo.cmm.msu.su/ )

• Custom Query ? Cyclyc Cell Automata

Главная Программы Магистратура Программа "Международный бизнес и стратегия" Курсы по выбору МА13 Весна 2013 . International Marketing (Abdolreza Eshghi) . ... Global marketing\'s main job is to create customer value in the global marketplace. This intensive seminar focuses on how managers evaluate global market opportunities and develop market entry and expansion strategies in order to create customer value on a global basis. ... Business Ethics (Gerald Rohan) . ...

Еще в разделе: (Показать все результаты (>1461) - www.mgubs.ru/ )

• The Ljubljana Summer school
• Конкурс на лучшее эссе года
• Преподаватель ВШБ МГУ Вячеслав Болтрукевич выступил на конференции EFMD

Lomonosov Moscow State University was established in 1755 . ... Lomonosov Moscow State University Diary . ... MSU Web Sites . ... Faculties . ... Faculty of Art (MSU), Russian Federation, Moscow, Bol'shaya Nikitskaya St. 3/1. ... http://www.arts.msu.ru . ... Lomonosov Moscow State University (MSU) is one of Russia?s most historic and prestigious university institutions. ... Performing Arts (Musical) . ... Lomonosov Moscow State University . ... Copyright 1997?2016 Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>135) - www.msu.ru/ )

• Faculty of Fine and Performing Arts
• Faculty of Philosophy
• FACULTY OF MATERIALS SCIENCE

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>91) - observ.pereplet.ru/ )

• Results.html

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>34) - ideas.msu.ru/ )

• http://ideas.msu.ru/news/19_10_2010/Press_release.pdf

I. (SCIENCE CITATION INDEX ­SCI) WEB OF SCIENCE Web of Science (WoS) , , , , , Web of Science. ... Search>. ... WEB OF SCIENCE (SCIENCE CITATION INDEX) , Web of Science <Cited Reference Search>, , <Search>. ... Russian Acad Sci, Boreskov Inst Catalysis, Siberian Branch; - RAS, Boreskov Inst Catalysis SB; - SB RAS, Boreskov Inst Catalysis; - Boreskov Inst Catalysis; - Inst Catalysis; - Novosibirsk Catalysis Inst; - Boreskov Inst Catalysis SB RAS; - Boreskov Catalysis Inst; - GK Boreskov Inst Catalysis. ...

Еще в разделе: (Показать все результаты (>39) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/courses/crchem/urusov2.pdf

. Number . Task . Pri . Author . Created By Tool . Created On . Modified On . Completed . Modified By . Assigned To . Link To . Magic . Description

Еще в разделе: (Показать все результаты (>33) - genphys.phys.msu.su/ )

• To Do List History

... 379.08 KB . ... 362.46 KB . ... 372.72 KB . ... 380.65 KB . ... 373.13 KB . ... 366.63 KB . ... 374.91 KB . ...

Еще в разделе: (Показать все результаты (>290) - www.geogr.msu.ru/ )

... The given course consisting of lectures and seminars is aimed at teaching our students a whole range of measures, which allow quick and efficient faultfinding, functional testing, reliability testing of a device, find replacement for a faulty component at the modern technological level, fix a device, create a similar device even without the blueprints. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ...

Еще в разделе: (Показать все результаты (>24) - engineering.phys.msu.ru/ )

... Inorganic Materials Sciences . ... At the same time at the Faculty of Physics and Mathematics of the Moscow University was founded the Inorganic Chemistry Division which was later transformed into a separate Department of Inorganic Chemistry of the MSU Faculty of Chemistry . ... The latter part of this program is successfully realized at both the Deartment and at the Department of Materials Sciences , the new faculty of MSU, which creation was initiated by the department of Inorganic Chemistry. ...

Еще в разделе: (Показать все результаты (>39) - www.inorg.chem.msu.ru/ )

... S. DNEPRO V SKII The enhancement of both the binding energy and the oscillator strength of excitons in nanostructures and the possibility to increase the strength of Coulomb interaction, responsible for the binding of electron­hole pairs to excitons, by combining semiconductor and dielectric materials with different values of dielectric constants allow to create excitonic devices operating at room temperature. , , ­ , , . ... GaAs Eex 4,2 , aex 15 . ... d aex), E 2D n R p 1 GaAlAs n 2 h - + GaAs i ....

Еще в разделе: (Показать все результаты (>111) - scon155.phys.msu.su/ )

• Anomalous relaxation of light-induced states of a-Si:H

... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...

116. Основной заголовок

117. aboutLab

118. Human Language - Язык Человека

119. ZOO

120. MsuNews.Ru