... The Laboratory of Bioorganic Chemistry and Molecular Imaging (LBCMI) at Swiss Institute of Technology, Lausanne (EPFL), Switzerland has an opening at the PhD level (http://lcbim.epfl.ch). ... The successful candidate should hold a master degree or equivalent in organic chemistry, chemical biology or other relevant discipline. ... The candidate should be open and interested in learning new techniques in biology and molecular imaging. ...

Еще в разделе: (Показать все результаты (>5) - www.chemport.ru/ )

• "Postdoc in France" - вакансия в разделе "Работа для химиков" @ChemPort.Ru
• "Postdoc position in structure-property studies of nanomaterials" - вакансия в
• "Product development manager russia" - вакансия в разделе "Работа для химиков"

... For full UV energy Euv (erg) radiated in TLE the corresponding number of photons of wavelength =300-400 nm (with average energy 3.5 eV) is: Nph=Euv/3.5в1.6 10-12 (1) We considered 2 options of the pinhole camera focal distance: 1. focal distance is short so that the circle of diameter 40 km is observed by one pixel and 2. focal distance is long so that the 40 km circle is observed in many camera pixels. ... Full energy released in UV in the atmosphere is determined by the pixel signal. ...

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )

Wavelet Analysis of E852 Experimental Data V. L. Korotkikh  and L. I. Sarycheva   Scobeltsyn Institute of Nuclear Physics, Moscow State University, Moscou 119899, Russia Abstract. A calculation of background in the hp 0 mass spectrum by the wavelet analysis is presented. ... A large final state statistics of E852 experiment [4, 5, 6] in the p p interactions at 18 GeV/c allows to use the wavelet analysis both for one­dimensional and for two­ dimensional distributions. ... are built (fig. ...

Еще в разделе: (Показать все результаты (>30) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/nir/papers/NIM_3000-LGD.pdf
• http://lav01.sinp.msu.ru/~vlk/report_E852.ps
• http://lav01.sinp.msu.ru/~vlk/UPC_2008_orig.pdf

The Octotron Approach: Towards Autonomous and Reliable Operation of Supercomputers Alexander Antonov, Dmitry Nikitenko, Pavel Shvets, Sergey Sobolev, Konstantin Stefanov, Vadim Voevodin, Vladimir Voevodin, Sergey Zhumatiy Research Computing Center, Lomonosov Moscow State University, Moscow, Russia {asa,dan,shpavel,sergeys,cstef,vadim,voevodin,serg}@parallel.ru 1 Introduction ... 2 The Octotron System: Model-based Approach Octotron represents the supercomputer model in the form of a graph (Fig. ...

Еще в разделе: (Показать все результаты (>12) - hpc.msu.ru/ )

• Octoshell: Lightweight and Innovative Cluster Management System | Moscow

... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...

Еще в разделе: (Показать все результаты (>30) - sn.sai.msu.ru/ )

О лаборатории . ... Лаборатория теоретической биофизики . ... The script generates nanotubes of arbitrary structure. ... To use it, save script to some file, then load into PyMol with the command: run /path/to/script.py . ... Here comes the script : # Nanotubes generating script for PyMol by piton at erg .biophys.msu.ru import cmd from math import cos,sin,pi,ceil,floor, acos from chempy import models, cpv class cell: def __init__(self ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>15) - erg.biophys.msu.ru/ )

• PyMol script for scanning potential energy surfaces ERG Research Group:

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>157) - www.pereplet.ru/ )

Unitherm for Windows (version 4.5) Contents Unitherm for Windows compared to Unitherm for DOS 2 General comments 2 Limitations of Unitherm for Windows compared to Unitherm for DOS 2 Changes in Unitherm interface 2 New functionality of Unitherm for Windows 2 Specific features of Unitherm for Windows 3 Localization 3 Graphical user interface of Unitherm for Windows 4 The main ... mode. ... The window is opened with the List of reactions command of the Unitherm Reaction menu. ...

Еще в разделе: (Показать все результаты (>17) - www.geol.msu.ru/ )

• Faculty of geology Moscow State Lomonosov University

... Starting : grid-proxy-init or voms-proxy-init -voms atlas [photon] 1. ... Printing information on a VOMS proxy : voms-proxy-info -all 9. ... Obtaining information about computing resources : lcg-infosites --vo photon ce [about CE] lcg-infosites --vo photon se [about SE] lcg-infosites --vo photon all [about CE+SE] lcg-infosites --vo photon closeSE lcg-infosites --vo photon lfcLocal [local LFC servers] 13. lcg-info command : lcg-info --list-attrs [Get the list of supported attributes] 14. ...

Еще в разделе: (Показать все результаты (>8) - lhe.sinp.msu.ru/ )

• Brief CompHep Installation Instruction

. <html> <head> <title>Пример 1. Сектор</title> </head> <body background = "../Gif/brick.gif"> <applet code=map_view.class name=red width=250 height=250 archive=map_view.zip codebase="../" mayscript> <param name=layers_all value="arc"> <param name=layers_draw value="#arc" > <param name=arc value="draw_layer=0x300"> <param name=arc_object_0 value=" arc 0x11 100 100 100 100 -30 90 id=0 "> </applet> </body> </html>

Еще в разделе: (Показать все результаты (>14) - adept.srcc.msu.ru/ )

• http://adept.srcc.msu.ru/adept/java/applet_book/layer/layer1text1.htm
• http://adept.srcc.msu.ru/adept/java/applet_book/layer/layer2text1.htm
• http://adept.srcc.msu.ru/adept/java/applet_book/layer/layer3text1.htm

arxiv:1307.8241 Кривая вращенияи распределение массы в центре Галактики --- от черной дыры до самых до окраин (Rotation Curve and Mass Distribution in the Galactic Center --- From Black Hole to Entire Galaxy) . Authors: Yoshiaki Sofue . ... Authors: D. Thornton et al. arxiv:1307.2944 Архив экзопланет NASA: Данные и инструменты для экзопланетных исследований (The NASA Exoplanet Archive: Data and Tools for Exoplanet Research) . ... обзор arxiv:1307.0041 Галактическая археология. ...

Еще в разделе: (Показать все результаты (>138) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/0910.html

. M. Prohorow, S. Kuranow . D. Kosenko stand . against background . of Donguz-Orun . At the mountain . Cheget . From the mountain . Cheget . Return from Azau . Walk with Darja Kosenko . along Cheget Slopes . Into Andyrchi to the . Ga-Ge-neutrino-detector . Scintillator-detector . W. Lukash, M. Prohorow, . D. Kompaneetc and i were . waiting for airplain . The day of waiting . for airplain . The Great Seven

Еще в разделе: (Показать все результаты (>4) - astrometric.sai.msu.ru/ )

... The documents on academic background should be translated into Russian and attested by the Russian Embassy in the country where the documents were issued, or by the Embassy of your country in Russia, or by a notary in Russia. Graduation certificate of the Center for International Education at MSU, or Preparatory Course at a state university in Russia, or Certificate of the Russian Language test and tests in Physics and Mathematics, . ... Russian Language Summer Program . ...

Еще в разделе: (Показать все результаты (>6) - foroff.phys.msu.ru/ )

• Postdoctoral training (General Physics and Wave Processes)
• Traditions of Students' Life

... The sphere radius is chosen as the characteristic length . ... Characteristic relaxation time . ... Heaviside . ... Hammitt . ... Cholesky . ... Хорда круга . Chord of a (the) circle . Хорда крыла . Wing chord . ... We are willing to use a little additional storage . ... Storage of matrices . ... Storage component . Хрупкий материал . Brittle material . Хрупкий отрыв . Brittle separation . ... Worse yet, it is possible for an accurate solution to have a large residual . ...

Еще в разделе: (Показать все результаты (>9) - num-anal.srcc.msu.ru/ )

... Results on advanced and complex systems will be presented. Tutorials on high performance computing and students' presentations will be organized Lecturers: Brivio G.P ., University of MilanoBicocca, Italy Colombo L., University of Cagliari, Italy Elliott J., University of Cambridge, United Kingdom Khokhlov A., MSU , Russia Korzh A., T-platforms ltd, Russia Morozov I., JIHT, Russia Mueller M., University of Gottingen, Germany Nemukhin A., MSU , Russia Potapkin B., ...

Еще в разделе: (Показать все результаты (>20) - polly.phys.msu.ru/ )

• Palyulin Hobbies
• Biography

... Hyper-Rayleigh scattering in nongomogeneous thin films and interfaces . ... N.V. Didenko , B.P. Antonyuk, N.N. Novikova, and O.A. Aktsipetrov , Light-induced c -nonlinear susceptibility and its 1/ w fluctuations in silica glasses, Phys. Lett. ... N.V. Didenko , A.A. Fedyanin, E.P. Lukashev, and O.A. Aktsipetrov, Nonlinear interferometry of second-harmonic generation and hyper-rayleigh scattering from thin inhomogeneous films, IQEC ’98 [San Francisco, USA, 1998, Technical Digest, p. 111-112]. ...

Еще в разделе: (Показать все результаты (>12) - shg.phys.msu.ru/ )

• Page3

SPAW Editor PHP Edition version 1.0.6 Release Notes Thanks to everyone who downloaded, tried and supported SPAW Editor! This release includes several new features: css classes for tables, background images in tables and table cells, improved link dialog and more. ... If you are fluent in any of languages that are now included and see any typos or mistakes please report to spaw@solmetra.com Happy editing, Alan Mendelevich a.k.a. ailon alan@solmetra.com ...

Еще в разделе: (Показать все результаты (>8) - textbook.sinp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Data . ... This creates a powerful system for detecting proton and electron fluxes in the near-Earth space. ... Protons . ... Protons 1-100 MeV (horizontal das1) . ... MSGI SKL electron 0.1 MeV electron 0.3 MeV electron 0.7 MeV electron 4 MeV electron 8 MeV electron 13 MeV proton 1-100 MeV proton 3-10 MeV proton 8-65 MeV proton 10-28 MeV proton 30-260 MeV proton 55-95 MeV electron 0.1 MeV electron 0.3 MeV electron 0.7 MeV ...

Еще в разделе: (Показать все результаты (>6) - smdc.sinp.msu.ru/ )

• Prognos-9 - Space monitoring data center

... Command(31:0) ­ ; Str_com ­ , ; Data(31:0) ­ , ; RDWR ­ , , ; Ack ­ - , , ; Irq - . ... 0 ) St robe _ com Ack 1 - C LK Data( 31 :0 ) RDWR Ac k 2 - Command(31:0) Str_com . ... CLK Dat a( 31 :0 ) RDWR Ack 3 - Data(31:0) RDWR, . ... Data(63:0) ­ , ; RDWR ­ , , ; Strobe_V ­ , , ; Ack ­ - , , ; Stop ­ ; Fail ­ ; CMD ­ ; wr_en_fifo ­ , FIFO ; prog_full_fifo ­ , , FIFO 2/3. ... 31 30 6 5 4 3 2 1 0 * * * Stop Fail Answ Strobe_V CMD 5 ­ 5: ­ 5 - S , ­ 4 - Fail , ­ 3 - Answ Ak -, , ­ 2 - Strobe_V , , , - . ...