This section of library contains information about "classic" Star Catalogs. ... For a Henry Draper Catalog 272149 stars have received a total of 531,211 identifications in 7 сatalogs: . 270456 - in Astrographic Catalogue ( "Carte du Ciel", 4M), . 251943 - in Guide Stars Catalog (GSC), . ... A file with information on the components of 1788 of multiple systems in catalog HDEC (3681 component, or a combination thereof, with 4054 recording). ... A file with information about 21971 variable stars. ...

Еще в разделе: (Показать все результаты (>8) - astrometric.sai.msu.ru/ )

. To see a Russian version of this page, click here . (Professor, Director of SAI. Graduated from the Moscow State University (MSU) in 1964, Ph.D. 1967, MSU, Dr. of Science 1975, MSU) . A member of IAU and EAS, IAU committees No 42, 27. Fields of interest: Stellar astrophysics, close binary systems, inverse problems in astrophysics. Send your mail to: cher@sai.msu.su .

Еще в разделе: (Показать все результаты (>15) - uranus.sai.msu.ru/ )

• Igor Antokhin
• Tatjana Khruzina
• Linux on CLEVO 8750

NONPERTURBATIVE QUANTIZATION OF NON-ABELIAN GAUGE THEORIES. ... The gauge invariance of the Higgs mo del allows to give a manifestly renormalizable theory describing a massive gauge theory. ... A very nontrivial generalization is obtained if further shifting the fields by constants. ... Higgs mo del. ... In the Higgs mo del one starts with the Lagrangian L = LY M + (Dµ)(Dµ) - 2( - µ2)2 (15) After the shift = + µ, µ = {0, µ} a, a = 1, 2, 3 b ecomes a ^ ^ gauge field:a a + µ a(x) + . ...

Еще в разделе: (Показать все результаты (>146) - nuclphys.sinp.msu.ru/ )

• E.L.Fainberg (right) International Seminar on high-energy physics problems,
• On the Chatyn-tau summit, Summer 1952. In that year A.M.Baldin received the

I. S. MAMAEV Institute of computer science 426034, Russia, Izhevsk Universitetskaya St., 1 E-mail: mamaev@rcd.ru NEW CASES WHEN THE INVARIANT MEASURE AND FIRST INTEGRALS EXIST IN THE PROBLEM OF A BODY ROLLING ON A SURFACE Received September 16, 2003 DOI: 10.1070/RD2003v008n03ABEH000249 Some new cases when the invariant measure and an additional first integral exist in the problem of a rigid body rolling on a sphere and on an ellipsoid are discussed in the paper. ... Rolling of a ball on a surface. ...

Еще в разделе: (Показать все результаты (>142) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/d07/157-isomorphisms-of-geodesic-flows-on-quadrics_en.pdf
• Institute of Computer Sciences - Publications

... News from the UNESCO Chair on Global Problems . ... ABOUT THE CHAIR . ... GENERAL INFORMATION ABOUT THE CHAIR . ... STAFF OF THE CHAIR . ... NETWORK OF THE CHAIR . ... Школа ЮНЕСКО / UNESCO SCHOOL . Визит Генерального директора ЮНЕСКО . ... Home News from the UNESCO Chair on Global Problems . ... 2005-2013 Факультет глобальных процессов МГУ имени М.В. Ломоносова / Исполнение и поддержка ресурса: Союз молодых ученых и специалистов Евразии ...

Еще в разделе: (Показать все результаты (>5) - unesco.fgp.msu.ru/ )

• ОБЩАЯ ИНФОРМАЦИЯ О КАФЕДРЕ ? GENERAL INFORMATION ABOUT THE CHAIR Кафедра ЮНЕСКО
• Кафедра ЮНЕСКО по изучению глобальных проблем на факультете глобальных

... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...

Еще в разделе: (Показать все результаты (>2) - sa.cs.msu.ru/ )

The Astronomical Journal welcomes new submissions at IOP Publishing . ... From: Andrew Wray < andrew.wray@iop.org > . ... On behalf of the IOP-AAS Project Team, I am delighted to announce that IOP Publishing is now processing all new submissions to the AJ. Submitting a new article . To submit a new article to the journal, go to http://authors.iop.org/aj , where you will find our beta version of the new AJ web submission site. ... Refereeing an article . ... IOP Publishing . ...

Еще в разделе: (Показать все результаты (>82) - sai.msu.ru/ )

... Individual SELEX products, aptamers, are small molecules (40­100 nt) that have a unique three-dimensional structure, which provides for their specific and high-affinity binding to targets varying from low-molecular-weight ligands to proteins. ... Selection of aptamers binding with a target is the key step in SELEX, as aptamers account for only a small fraction of the initial library (one aptamer per 109 to 1013 molecules) [6]. ... Fourth, modification can increase the aptamer affinity for a target. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2003.pdf

. Please standby and you will be automatically connected to the new location of the unframed Supernova page. Or, click on the link above. If you have questions or problems, please email me at David Bishop dbishop@vhdl.org . Last modified: Mon Aug 27 12:40:15 EDT 2001

Еще в разделе: (Показать все результаты (>35) - www.rochesterastronomy.org/ )

• Supernova 1998T in NGC 3690
• Supernova 2003aa in NGC 3367
• Supernova 2004aw in NGC 3997

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>56) - acoustics.phys.msu.ru/ )

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... The Department of Television and Radio Broadcasting was established in 1958. The department was the first in the USSR and in Russia, where the theoretical foundations of television and radio broadcasting were studied and taught.љ ... Textbooks and monographs written by professors and lecturers of the department are widely used in Journalism Schools both in Russia and abroad. ...

Еще в разделе: (Показать все результаты (>48) - www.journ.msu.ru/ )

• The round table ?Problems of regional television in Russia? :: Department of
• Lecture of Professor Robert Weisbrot (Colby College, USA) :: Department of

О факультете . ... Психологи МГУ . ... История факультета . ... Совет по психологии УМО университетов РФ . ... Правила приема на факультет психологии МГУ . ... Клуб выпускников факультета психологии МГУ . ... Consciousness as a Central Problem of Modern Psychology . ... Methodological Foundations of Military Psychology and Psychological Security . ... Security Psychology as Social Systemic Phenomenon . ... Факультет психологии Московского государственного университета им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>170) - www.psy.msu.ru/ )

... MSU Web Sites . ... Faculties . ... MSU, Faculty of Mechanics and Mathematics, Russia, 119991, Moscow, GSP-1, 1 Leninskiye Gory, Main Building . ... The most abstract branches of mathematics, such as mathematical logic, functional analysis, topology, modern algebraic theories, have recently found a number of practical applications too. ... The Faculty of Mechanics and Mathematics is affiliated with the MSU Institute of Mechanics whose research work embraces all the main areas of Mechanics. ...

Еще в разделе: (Показать все результаты (>107) - www.msu.ru/ )

• Faculty of Soil Science
• International Summer Schools at Lomonosov Moscow State University
• Research Priorities in Sciences and Humanities at Moscow State University

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>27) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Moscow State University . INTERNATIONAL CONFERENCE . ... Moscow, Russia . ... Institute of Mechanics of MSU . ... The aim of this Conference is gathering active researchers and students in the field of nonlinear fluid dynamics in order to provide a forum for discussions. Since 1976 through 2008 the Conference was organized by the Institute of Mechanics of Moscow State University (see http://hit2003.narod.ru/ ). ... Institute of Mechanics , Moscow State University . ...

Еще в разделе: (Показать все результаты (>29) - hit-conf.imec.msu.ru/ )

... A B? · : ­ ­ Sender Window Size ­ ­ Last ACK Received ­ ­ Last Segment Sent ­ ­ · : ­ ­ ­ ­ ­ Receiver Window Size ­ Largest Acceptable Segment ­ Last Segment Received - SW #1 1 Sender : SWS = 3 LAR = 0 LSS = 1 Receiver : RWS = 1 LAS = 1 LSR = 0 SW #1 1 2 Sender : SWS = 3 LAR = 0 LSS = 2 Receiver : RWS = 1 LAS = 1 LSR = 0 SW #1 1 2 3 Sender : SWS = 3 LAR = 0 ... SW #3 · p = 16 * 8 = 128 . ... 50 128 = = 64 / -3 100 10 SW #4 · A 32 B SW. RTT = 80 , 128 /. ...

Еще в разделе: (Показать все результаты (>10) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/4-2wireshark.pdf
• http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Higher School of Management and Innovation (Faculty of Lomonosov MSU) was founded in June 2006 by the Academic Council on the initiative of the Moscow State University Rector, academician V.A. Sadovnichiy and Chairman of the Board of Directors of JSFC "Sistema" V.P. Yevtushenko. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>10) - hsmi.msu.ru/ )

The Smalltalk-76 Programming System . ... This paper describes a programming system based on the metaphor of communicating objects. ... In this way, meaning rides with the objects of the system, and code remains an abstract form, merely directing the flow of communication. ... Beyond the laudable goals of modularity and factoring, four pragmatic issues affect the performance of the Smalltalk system: storage management, compact object code, message handling, and a decent virtual memory. ...

Еще в разделе: (Показать все результаты (>138) - sp.cs.msu.ru/ )

• Design Principles Behind Smalltalk
• Blue Book Chapter 28
• Lib-DVM library. Detailed design. Part 3 (12.16-12.18)

... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>2) - www.imec.msu.ru/ )

• EUROMECH Colloquium-458

XXIII ICTAM, 19­24 August 2012, Beijing, China CASES OF INTEGRABILITY IN DYNAMICS OF A RIGID BODY INTERACTING WITH A RESISTANT MEDIUM Maxim V. Shamolin Institute of Mechanics, Lomonosov Moscow State University, Moscow, 119899, Russian Federation Summary The author discovers new integrable cases of the rigid body motion in a resisting medium, including those in the classical problem of motion of a spherical pendulum placed in the over-running medium flow. ...

Еще в разделе: (Показать все результаты (>42) - shamolin2.imec.msu.ru/ )