... 10:00- 10:45 10:45- 11:30 Opening Ceremony Albert Nikolaevich Shiryaev, Steklov Mathematical Institute , RAS, Moscow , Russia Friedrich GЖtze, Bielefeld University , Germany Entropy Expansions in Probability Narayanaswamy Balakrishnan, McMaster University , Hamilton, Ontario, Canada Signatures Alexander Ivanovich Sakhanenko, Novosibirsk State ...

Еще в разделе: (Показать все результаты (>129) - en.cs.msu.ru/ )

• Laboratory of Ternary Informatics | CMC MSU
• Department of Mathematical Statistics | CMC MSU
• Department of Mathematical Statistics

Nonlinear Dynamic Phenomena in Physiological Control Systems Mosekilde E. BioSim Coordinator EU Network of Excellence Department of Physics, Technical University of Denmark, Kgs. Lyngby, 2800, Denmark; e-mail: erik.mosekilde@fysik.dtu.dk The purpose of this talk is to demonstrate the essential role that nonlinear dynamic phenomena play in normal physiological regulation and in the development of various diseases. As an example we consider renal auto-regulation in normo- and hypertensive rats. ...

Еще в разделе: (Показать все результаты (>72) - www.msm.biophys.msu.ru/ )

• MSM 2007

... The asymmetric stratification structure allows instabilities to radiate gravity wave energy from the upper flank of the jet to the lower flank, where it encounters a critical layer. ... Each mode extracts energy from the mean flow near both the 6 upper and lower critical levels, as is evident from the energy flux profiles in figure 4. ... The new mode class seen in figure 6 resembles the S mode in that it extracts energy from the mean flow primarily near its upper critical level (figure 7c). ...

Еще в разделе: (Показать все результаты (>12) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/science/nosov/EGU2010_initial_condition.pdf

PRL 107, 098301 ( 2011 ) PHYSICAL REVIEW LET TE RS week ending 26 AUGUST 2011 Electro-osmosis on Anisotropic Superhydrophobic Surfaces Aleksey V. Belyaev1,2 and Olga I. Vinogradova 1 2 1,2,3 Department of Physics ... Prospect, 119991 Moscow, Russia 3 ITMC and DWI, RWTH Aachen University, Pauwelsstrasse 8, 52056 Aachen, Germany (Received 15 March 2011 ; published 23 August 2011 ) We give a general theoretical description of electro-osmotic ... Far from the surface, y ! ... negatively charged. ...

Еще в разделе: (Показать все результаты (>69) - electr003.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/rus/asp/asp2012_7.pdf
• http://www.elch.chem.msu.ru/rus/asp2/b3L3.pdf
• http://www.elch.chem.msu.ru/rus/alekseeva.pdf

Vol.30,1978 435 A remark on nonsymmetric compact Riemann By surfaces D~AR G~B~ Let G be a group of automorphisms of a compact Riemann surface of genus g > 1. ... Singerman Eves one of genus g ---- 17 and some others of higher genus. this note we classify all K-automorphism groups of compact Riemann surfaces of genus 7. ... Apart from isomorphic copies there exist exactly two nonsymmetric Riemarm surfaces of genus 2 g g < 7 whose group is a K-automorphism group. ...

Еще в разделе: (Показать все результаты (>31) - dfgm.math.msu.su/ )

... Advanced chapters of operation research . Algebraic characterization of basic solution of linear program. ... Advanced chapters of Actuarial Mathematics . ... Discounted cash flow analysis and capital budgeting as decision tools are given particular emphasis. ... In the first part of the course we present a modern approach to modeling economic systems. ... The problem of tax optimization under a given financing budget. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>13) - hcs.cmc.msu.ru/ )

... This is so elementary it hardly needs comment . ... Единица (меньше единицы по модулю) . ... Group unit element . ... Единичная геометрическая краткость . ... Unit normal . ... Let $v$ be a vector of unit length . Единичный вектор внешней нормали . Unit outer normal vector . Outer normal unit vector . Единичный вектор восходящей нормали . ... Единичный вектор касательной . ... Единичный вектор направления движения . ... Normal unit vector . Unit normal vector . ... One component . ...

Еще в разделе: (Показать все результаты (>173) - num-anal.srcc.msu.ru/ )

... There is no trigger -- channels are sampled continuously and written first to disk, later to tape Total data rate from each interferometer: ~3 MB/sec Gravitational wave channel is only ~2% of the data stream Data to be archived: ~100-200 TB per year ACAT 2002 Peter Shawhan ( LIGO / Caltech ) Gravitational-Wave Data Analysis Different scientific topics require different ...

Еще в разделе: (Показать все результаты (>49) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/james/moscow.slides.ps

... О UNИX . ... ReStructuredText . ... The Parser in MoinMoin . ... Support for MoinMoin-specific link schemes . ... Before you can use it, you need to install the Python docutils package, which provides the additional Re Structured Text support that MoinMoin needs. ... rst Here is a link to a page attachment__. __ attachment:Attachment.zip }}} . ... If the attachment for the page does not exist, the link text will be replaced with the typical MoinMoin replacement text for uploading an attachment. ...

Еще в разделе: (Показать все результаты (>184) - uneex.mithril.cs.msu.su/ )

• HelpOnInstalling/WikiInstanceCreation - UNИX
• HelpOnComments - UNИX
• HelpOnAuthentication/ExternalCookie - UNИX

... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...

Еще в разделе: (Показать все результаты (>8) - uhecr.sinp.msu.ru/ )

• Новости КЛПВЭ

Academy of Science, Engineering and Technology International Journal of Chemical, Nuclear, Metallurgical and Materials Engineering Vol :8 No:10, 2014 Kohonen Self-Organizing Maps as a New Method for Determination of Salt Composition of Multi-Component Solutions Sergey A. Burikov, Tatiana A. Dolenko, Kirill A. Gushchin, Sergey A. Dolenko Abstract--The paper presents the results of clusterization by Kohonen self-organizing maps (SOM) applied for analysis of array of ... T I. INTRO DUCTION water. ...

Еще в разделе: (Показать все результаты (>28) - rswater.phys.msu.ru/ )

• Laboratory of laser spectroscopy of solutions of supramolecular compounds and

... The "diagrams of minimum expected tsunami arrival time" are shown for 25 coastal sites; the TWS dead zones for each of these sites are distinguished by more frequent isolines (every 1 min). ... I ( is the site name). ... We presented isolines of minimum expected tsunami time for all these sites. ... However, there are also sites, In every such case the minimum expected tsunami time tmin has to be to the minimum tsunami propagation time at the distance R in the direction to the respective settlement....

Еще в разделе: (Показать все результаты (>21) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E01_Armigliato.pdf

... Furman and A.V.Tikhonravov, "Basics of optics of multilayer systems" , Editions Frontiers, Gif-sur Yvette, 1992, 242 p. A.V. Tikhonravov, M.K. Trubetskov, I.V. Zuev and P.G. Verly, "Efficient Refinement of Inhomogeneous Optical Coatings", in "Optical Interference Coatings", OSA Technical Digest Series, vol. ... A.V. Tikhonravov, M.V. Klibanov, I.V. Zuev, "Numerical study of the phaseless inverse scattering problem in thin film optics", Inverse problems, 1995, Vol. 11, pp. ... Основные публикации . ...

Еще в разделе: (Показать все результаты (>22) - www.srcc.msu.ru/ )

... wwf 17 декабря 2004 17:19:27 . ... Отвечаю по индексу вегетации. ... В красной области спектра (0,6-0,7 мкм) лежит максимум поглощения солнечной радиации хлорофиллом высших сосудистых растений, а в инфракрасной области (0,7-1,0 мкм) находится область максимального отражения клеточных структур листа. ... Картирование по NDVI позволило четко отделить растительные от прочих природных объектов и проанализировать диапазон значений индекса вегетации. ... wwf mailto:wwf@olekma.sakha.ru . ...

Еще в разделе: (Показать все результаты (>25) - www.ecocoop.ru/ )

... BOAI: наука должна быть открытой . Наука >> Математика | ... Написать комментарий . ... Преподаватель школы и вуза во Франции -- это достаточно престижная профессия (в отличие, скажем, от США, где социальная оценка учителя очень проста: "неудачник"). ... Правда, в отличие от учителей российских государственных школ, учителя во Франции не получают централизованного поурочного расписания: порядок и хронологию изложения тем, входящих в программу данного учебного года, определяет учитель. ...

Еще в разделе: (Показать все результаты (>356) - www.nature.web.ru/ )

• Факторы роста и их роль в регуляции репродуктивной функции у больных с
• Состояние эндотелийзависимой и эндотелийнезависимой функций неизмененных и
• Сравнительный анализ морфологии сперматозоидов человека: нативный эякулят

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out

... Assessment of water quality under changing climate conditions . ... Scope: Climate change coupled with geographically heterogeneous population growth, land use change, increasing urbanization, and changing water use are expected to have major effects on water supply and water quality. ... Climate change effects on streamflow, timing of snowmelt, timing and magnitude of groundwater recharge, ecosystem responses, and impacts of changing land cover and land use are likely to affect water quality. ...

Еще в разделе: (Показать все результаты (>32) - eng.geogr.msu.ru/ )

... The live in the North is a waiting of a vacation and a New Year holiday.. ... Theoretical approach: vacation as a temporal geographic proximity Temporal proximity theory: A. Torre Base for temporal proximity as a solid base of interregional contacts: -The system of two (or more) dwelling (both in the North and the South ) - Social networks Institutional conditions of proximity usage: - A paid vacation trip for all having job in Russian Arctic -Readiness to use weak ...

Еще в разделе: (Показать все результаты (>200) - www.geogr.msu.ru/ )

Daniil Itkis (Moscow U) Q: What about thermal stability of Li-air batteries? ... If we exclude the issues connected with thermal stability of battery packaging materials from our consideration there still will be2 limitations: lithium melting temperature (about 180oC) and rapid electrolyte evaporation at elevated temperature. ... Q: Is it possible to use Li-air batteries at -40 C? The major problem at -40oC is low Li+ conductivity of electrolytes. ...

Еще в разделе: (Показать все результаты (>19) - www.elch.chem.msu.ru/ )

. Print . Details . Written by Sergey Zapunidi . Published: 30 November -0001 . Just one day (2014-03-07) 166 times faster. Good quality. 87 MB. Normal quality. 46 MB. Download and watch (XVid). 90 MB. Download

Еще в разделе: (Показать все результаты (>17) - engineering.phys.msu.ru/ )