1) Soil Science Faculty, Moscow State University, Moscow 119899, Russia . 2) Faculty of Physics, Moscow State University, Moscow 119899, Russia . ... Long-term response of sandy podzols to acid deposition near the nickel smelter in the Kola Peninsula, north-western Russia, was evaluated with the SMART model. The present acid load does not effect considerably on forest soils in background areas. The dramatic shift in soil chemistry near the smelter is expected within several decades. ...

Еще в разделе: (Показать все результаты (>21) - eco.soil.msu.ru/ )

... Research objects and scientific purposes . Space scientific program includes development and launch of two supersmall spacecrafts "Universitetskiy" and "Kompas-2" intended for monitoring of radiation conditions near the Earth. ... All the studies conducted in the near-Earth space are characterised by strong radiation fields. ... The circular polar orbits, which cover all the near-Earth space, are the most favorable for comprehensive studies of the radiation conditions near the Earth. ...

Еще в разделе: (Показать все результаты (>67) - cosmos.msu.ru/ )

• University Satellites and Space Science Education '2006

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>31) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/Evaluation_panels.pdf

Mathematical Modeling of Complex Information Processing Systems 93 DESIGN OF THE EAS CHERENKOV ARRAY FOR THE CERRA LA NEGRA SITE P. Bello 1 , G. K. Garipov 2 , B. A. Khrenov 2 , O. Martinez 1 , E. Moreno 1 , H. Salazar 1 , A. A. Silaev 2 , L. Villasenor 3 , and A. Zepeda 4 The design of the air Cherenkov detector array for the Cerra La Negra site (an elevation of 4 km) is presented. ... Statistics of the registered EAS depends on a sensitivity area \Sigma of the air Cherenkov array. ...

Еще в разделе: (Показать все результаты (>39) - num-anal.srcc.msu.ru/ )

• http://num-anal.srcc.msu.su/eng_math/redict/16.htm
• http://num-anal.srcc.msu.su/eng_math/redict/17.htm

PRL 102, 118302 (2009) PHYSICAL REVIEW LET TE RS week ending 20 MARCH 2009 Direct Measurements of Hydrophobic Slippage Using Double-Focus Fluorescence Cross-Correlation Olga I. Vinogradova,1 Kaloian Koynov,2 Andreas Best,2 and Francois Feuillebois3 ... 75231 Paris Cedex 05, France (Received 29 January 2008; published 20 March 2009) We report the results of direct measurements of velocity profiles in a microchannel with hydrophobic and ... FIG. ... Phys. 119, 13106 (2003). ...

Еще в разделе: (Показать все результаты (>49) - nanofluidics.phys.msu.ru/ )

• http://nanofluidics.phys.msu.ru/paper/JCP2014.pdf
• http://nanofluidics.phys.msu.ru/paper/jcp20042.pdf
• http://nanofluidics.phys.msu.ru/paper/jcp2008.pdf

... Paradigm shifts by Kuhn: successive change of one model by another, rather than integration of different paradigms Progress of science: from single- to multi-model approach Some examples from natural science... · theory of light: from vibration of ether to wave-particle duality · laws of motion: from Newton's dynamics to SchrЖdinger 's and Heisenberg's formalism In social and environmental sciences appreciation of the multi-model ...

Еще в разделе: (Показать все результаты (>5) - oc.cs.msu.ru/ )

... Version 2.0 modifies version 1.8 to include explicit statistical estimates for similarity scores based on the extreme value distribution. ... TFASTA with ktup=2 is about as fast as a DNA FASTA with ktup=4, and is substantially more sensitive. (also reads the GENBANK library) TFASTX Search DNA library for a protein sequence by translating the DNA sequence to protein in all six frames (three forward frames with the -3 command line option) calculating similarity scores that allow frameshifts. ...

Еще в разделе: (Показать все результаты (>205) - www.genebee.msu.ru/ )

• Laboratory of protein-nucleic interactions (Russian version)
• BLAST Frequently Asked Questions (FAQ)
• Tumor necrosis factor (TNF) is an inflammatory cytokine that can induce cells

... The main field of my investigations is stellar spectrophotometry. As a result of scientific activity of our group spectrophotometric catalog was created including energy distribution data on 900 stars in the range 3200-7600AA and 250 stars in the range 6000-10800AA (Voloshina et al., Spectrophotometry of Bright Stars, ed. I.N.Glushneva, 1982, Moscow, Nauka, in Russian). ...

Еще в разделе: (Показать все результаты (>13) - uranus.sai.msu.ru/ )

EFFECT OF pH AND VFA ON H YDROLYSIS OF ORGANIC SOLID W ASTE By Adrie Veeken,1 Sergey Kalyuzhnyi,2 Heijo Scharff,3 and Bert Hamelers4 ABSTRACT: The anaerobic hydrolysis rate of organic solid waste was studied at fixed volatile fatty acid (VFA) concentrations ranging from 3 to 30 g COD/ L and fixed pH values between 5 and 7. ... In this way, it was possible to distinguish between the inhibitory effects of pH, total VFA, and undissociated VFA on anaerobic hydrolysis. ... VFA control. ...

Еще в разделе: (Показать все результаты (>141) - www.enzyme.chem.msu.ru/ )

... Assessment of water quality under changing climate conditions . ... Scope: Climate change coupled with geographically heterogeneous population growth, land use change, increasing urbanization, and changing water use are expected to have major effects on water supply and water quality. ... Climate change effects on streamflow, timing of snowmelt, timing and magnitude of groundwater recharge, ecosystem responses, and impacts of changing land cover and land use are likely to affect water quality. ...

Еще в разделе: (Показать все результаты (>35) - eng.geogr.msu.ru/ )

... Russian Journal of Nonlinear Dynamics, 2010, vol. 6, no. 3, pp. ... Vaskin V. V., Erdakova N. N., Statistical mechanics of relativistic gas in a one-dimensional tube, Russian Journal of Nonlinear Dynamics, 2009, vol. 5, no. 4, pp. ... Vaskin V. V., Erdakova N. N., Mamaev I. S., Statistical mechanics of nonlinear dynamical systems, Russian Journal of Nonlinear Dynamics, 2009, vol. 5, no. 3, pp. ... Computer Science, 2009, no. 2, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>105) - ics.org.ru/ )

... Physical Chemistry Division , . Department of Chemistry , . M.V.Lomonosov Moscow State University , . Moscow 119991 Russian Federation . ... Undergraduate student, Special Group for Physical Chemistry, Chemistry Department, Moscow State University. ... Physical Chemistry . ... 2005 - International Mendeleev's Chemistry Olympiad, Tajikistan - Silver Medal . 2006 - International Mendeleev's Chemistry Olympiad, Armenia - Gold Medal . ...

Еще в разделе: (Показать все результаты (>10) - lcc.chem.msu.ru/ )

Development of new approaches to the analysis of ring shapes in organic molecules and the description of electronic distribution (atomic charges) and halogen bonding in the framework of forcefield model for rapid estimation of intra- and intermolecular interaction energies in molecular mechanics, molecular dynamics and docking methods . Forcefield is a model and a set of parameters for theoretical description of intra- and intermolecular interactions. ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>11) - qsar.chem.msu.ru/ )

... Generation and interaction of vector solitary waves in isotropic gyrotropic media with cubic nonlinearity. student: A.N. Kiryuhin scientific advisor: V.A. Makarov We numerically investigated the propagation modes of light pulses in isotropic gyrotropic media with anomalous frequency dispersion and spatial dispersion of cubic nonlinearity. It was determined that polarization characteristics have non-homogeneous distribution along the pulse. ...

Еще в разделе: (Показать все результаты (>242) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2014/Larkin_Uryupina_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2015/Gavrev_Magnitsky_en.pdf
• Публикация

Московский государственный университет имени М.В.Ломоносова Основан в 1755 году . ... МГУ имени М.В.Ломоносова . ... 8 апреля 2016 года в Ломоносовском корпусе МГУ имени М.В.Ломоносова состоялась церемония награждения победителей и призеров олимпиады ?Покори Воробьевы горы!? ... 6 апреля 2016 года в МГУ состоялся очередной концерт из цикла ?Ректор Московского университета приглашает?? ... Московский государственный университет имени М.В.Ломоносова . ... Copyright 1997?2016 МГУ имени М.В.Ломоносова . ...

Еще в разделе: (Показать все результаты (>62) - www.msu.ru/ )

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out

. Some individual experimental Cerenkov light LDF fits. Experimental pulse example. Differential energy spectrum. Tunka-25 energy spectrum among some other experimental data. Mean depth of EAS maximum with two different methods. EAS maximum depth distributions for two energies. Open histograms - experiment. Filled histograms - simulation for QGSJET-01 and complex composition.

Еще в разделе: (Показать все результаты (>30) - dbserv.sinp.msu.ru/ )

International Journal for Parasitology 32 (2002) 817-824 www.parasitology-online.com Host manipulation by Ligula intestinalis: a cause or consequence of parasite aggregation? ... Here we consider whether these behavioural changes are important in shaping the distribution of parasite individuals across the fish population. ... Keywords: Ligula intestinalis; Roach; Macroparasitic aggregation; Host manipulation 1. ... Inference of parasite-induced host mortality from distributions of parasite loads. ...

Еще в разделе: (Показать все результаты (>42) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Bonferroni_deMeeus.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Crazy_Fred.doc

... Advanced chapters of operation research . Algebraic characterization of basic solution of linear program. ... Advanced chapters of Actuarial Mathematics . ... Discounted cash flow analysis and capital budgeting as decision tools are given particular emphasis. ... In the first part of the course we present a modern approach to modeling economic systems. ... The problem of tax optimization under a given financing budget. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>9) - hcs.cmc.msu.ru/ )

Radiochemical Approach for Studying Properties of Humic Substances Maria G. Chernysheva1, Gennady A. Badun1, Irina V. Perminova1, Viktor I. Korobkov1, Zinaida A. Tyasto1, Elena Yu. ... To prove the developed technique of HS labeling with tritium, parent HS and obtained samples of 3H-HS was analyzed by SEC with radioactivity and UV detection. ... To characterized hydrophobic and surface activity properties of HS under study, the obtained 3H-HS samples of corresponding initial humic materials were used. ...

Еще в разделе: (Показать все результаты (>152) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2012/2012-karpiouk-self.pdf
• http://www.mgumus.chem.msu.ru/publication/2006/2006-khasanova-neptunium.pdf
• http://www.mgumus.chem.msu.ru/publication/2008/2008-gaspar-multiple.pdf