... Two-dimension linear regression model. ... The econometric modeling of time series . ... The course aims to provide students with basic models and methods of econometric modeling of financial time series. ... The course considers in detail the major methods of econometric modeling of time series, in particular modeling by stochastic processes, modeling of stationary and non-stationary time series, the spectrum analysis of time series. ... The problem of tax optimization under a given state budget. ...

Еще в разделе: (Показать все результаты (>6) - io.cmc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• StructAlign help

Linear Algebra and its Applications 337 (2001) 87­108 www.elsevier.com/locate/laa Transformation to versal deformations of matrices Alexei A. Mailybaev Institute of Mechanics, Moscow State Lomonosov University, Michurinsky pr. ... Keywords: Versal deformation; Normal form; Transformation; Lie algebra; Jordan algebra; Reversible matrix 1. ... Arnold [1,3] defined and studied normal forms of deformations of complex matrices (called versal deformations). ... A is the Jordan normal form A = diag(J1 ,.. ...

Еще в разделе: (Показать все результаты (>27) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/papers/KuznetsovEtAl2008.pdf
• http://mailybaev.imec.msu.ru/papers/Mailybaev2000.pdf
• http://mailybaev.imec.msu.ru/papers/Mailybaev1999a.pdf

# # ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 23:59:38 Sun, 19 Dec 2010 20:49:42 GMT Alex Martynov <martiran@тАж> [53:91160a357d1a] merge Sun, 19 Dec 2010 20:49:01 GMT Alex Martynov <martiran@тАж> [52:f12238066c6d] * engine.py (modified) engine.Cell.__eq__ fixed Sun, 19 Dec 2010 20:48:39 GMT Daniil Alexeyevsky <me.dendik@тАж> [51:995c5300f498] * snake.py (modified) Added Cell attribute snake_type to snake.Rule pattern cells

Еще в разделе: (Показать все результаты (>203) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/snake/log/?format=changelog&rev=53%3A91160a357d1a&stop_rev=51%3A995c5300f498&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/snake/log/?format=changelog&rev=91160a357d1a370e19eb3ce00fb64213bbe25d77&stop_rev=51%3A995c5300f498&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/snake/log/?format=changelog&rev=51%3A995c5300f498&limit=100&mode=stop_on_copy

... Laboratoire Genetique et Evolution des Populations Vegetales, UMR 8016, CNRS, Universite Lille1, F-59655 Villeneuve d'Ascq, France Department of Biology, Section of ... State University, Leninskiye Gory 1, Moscow 119992, Russia article info abstract UNCORRECTED Article history: Received 13 April 2008 Accepted 30 August 2008 Published online Keywords: Sea beet Evolutionary optimization Resource allocation Dynamic programming Life-history traits Age at ... The Evolution of Life...

Еще в разделе: (Показать все результаты (>32) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Longev_JEvolBio.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2003_Envir_human_EER.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>6) - mph.cmc.msu.ru/ )

RIDGE AND TREE FEATURE DETECTION ON IMAGES A. Levashov 2, D. Yurin3 2, 3 1 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia 2 alexeylevashov89@gmail.com , 3yurin@cs.msu.ru In this article a new ridge detector with improved non-maxima suppression procedure in scale-space is proposed. ... The algorithm is tested on synthetic, landscape and medical images. ...

Еще в разделе: (Показать все результаты (>8) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2013.PRIA.Mamaev_Lukin_Yurin.HermiteNLM.en.pdf
• http://imaging.cs.msu.su/~yurin/Doxyfile

Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...

Еще в разделе: (Показать все результаты (>3) - cell.biophys.msu.ru/ )

• http://cell.biophys.msu.ru/static/announce/media/files/Franze2007_Muller_cell_waveguide.pdf

... О кафедре . ... Научная работа . ... Главная Научная работа Математические модели взаимодействия элементарных и структурированных объектов . ... Ведущий научный сотрудник Эльтеков В.А. В разное время в состав группы входили: Н.Н.Шапошников, А.В.Овсянкин, В.Б.Шикалов, Н.Г.Васичкина (кафедра математики), Л.П.Развина, О.В.Попова, Н.Н.Негребецкая (кафедра физической электроники), В.Н.Самойлов, Н.Г.Ананьева (кафедра общей физики). ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>7) - matematika.phys.msu.ru/ )

• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Наши

Sample Submission Form for Example Measurements In order to provide the best and most appropriate measurement/results, the customer is asked to please fill in the following form and enclose it with the sample. This form or equivalent information is required prior to the sample measurements. ... WITec can not provide specialised sample preparation. Measurement Goal: What's the goal of the measurement? ...

Еще в разделе: (Показать все результаты (>5) - nano.msu.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>4) - iconolat13.phys.msu.ru/ )

... Полная версия: Experimental Zone [top secret] . Грация-МГУ::Форум > Общение > Общение . ... Apr 11 2007, 14:38 . ... Небезызвестно, что в процессе традиционного совместного общения коллектива периодически всплывают всевозможные истории\байки\притчивоязыцех\тайныпокрытыемраком\итдитп, вызывающие массу эмоций - от всеобщего ржача и бури оваций до священного трепета. ... Цитата(Weasel @ Apr 11 2007, 15:38) . ... Цитата(AleXP @ Apr 11 2007, 22:10) . ... Цитата(Старый сисадмин @ Apr 11 2007, 23:02) . ...

Еще в разделе: (Показать все результаты (>3) - grace.msu.ru/ )

• Experimental Zone [top secret] - Грация-МГУ::Форум

30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )

Network Working Group T. Berners-Lee Request for Comments: 1945 MIT/LCS Category: Informational R. Fielding UC Irvine H. Frystyk MIT/LCS May 1996 Hypertext Transfer Protocol -- HTTP/1.0 Status of This Memo This memo provides information for the Internet community. This memo does not specify an Internet standard of any kind. Distribution of this memo is unlimited. IESG Note: The IESG has concerns about this protocol, and expects this document to be replaced relatively soon by a standards track document.

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2068.txt

... В.И.Дмитриев Электромагнитные поля в неоднородных средах Изд-во Моск. ун-та, Москва 1969, с.131 . ... Изд-во 'Диалог-МГУ', 1997,с.168. ... Прикладная математика и информатика', Изд-во 'Диалог-МГУ', 1999,с. 68-77. ... Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г.,?7, с.5-18. ... В трудах 'Прикладная математика и информатика', ?2, Изд-во 'Диалог-МГУ', 1999,с. 5-17 . ... Сборник работ 'Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г., ?9, с. 46. ...

117. http://dbserv.sinp.msu.ru/RSWI/sun.pdf

118. http://miles.sinp.msu.ru/files/Berlin06_Laser.pdf

119. Кафедра Ихтиологии Биологического факультета МГУ