... A Primer from the Reform of Personal Income Taxation in Russia Introduction. ... However, to use the welfare function one needs to aggregate individual preferences that can also be unknown. ... The derivations lead to the conclusion that the optimal marginal income tax rate is increasing as the elasticity of labor supply increases. ... In this paper we obtain the characteristics of the labor supply for different population groups to get the elasticities of labor supply with respect to a post tax...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf -- 233.1 Кб -- 06.07.2014 Похожие документы
... Архитектура пакета . ... Пакет содержит типы данных и алгоритмы для поддержки теории формальных языков в системе Maple. ... Для представления символов используется тип type/character , Для представления цепочек тип type/string . ... Основной новый тип: Language . ... Каталог с исходными текстами пакета имеет следующую структуру. src\ . ... Конструкторы и утилиты к типу Language . ... Конструкторы и утилиты к типу Acceptor . ... конструкторы объектов имеют префикс new , например: newLanguage() . ...
... 2015 . ... Ph.D., School of Public Administration, Lomonosov Moscow State University. ... The network form of organization is characterized by personalization, individualization and identification of interpersonal relations. Coordination mechanism is the principle by which the basic requirements and expectations in various areas (communication and feedback behavior, group behavior, compromising, honesty, integrity, reliability) are regulated. ... Public Administrarion". ...
... В общее использование помещена новая версия Конвертера FORPAS для автоматизированного перевода программ с языка Фортран на язык Паскаль, в которой расширен круг использования операторов PRINT для параметров печати, задаваемых выражениями. ... В общее использование помещена новая версия Конвертера FORPAS для автоматизированного перевода программ с языка Фортран на язык Паскаль, включающая возможность обработки фортранной конструкции IF-THEN-ELSE . ...
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
... Публикации . ... 1, 012506 DOI . ... 1, 012509 DOI . ... 1, 103598 DOI . ... Edge field emission of large-area single layer graphene Kleshch V.I., Bandurin D.A., Orekhov A.S., Purcell S.T., Obraztsov A.N. Applied Surface Science, Elsevier BV (Netherlands) DOI . ... Graphene Formation on Surfaces of Single Crystal Metals Shvets P.V., Soon J.M., Verger A., Obraztsov A.N Journal of Nanoelectronics and Optoelectronics, American Scientific Publishers (United States) DOI . ... Материалы, ? ...
HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...
. КОМПЬЮТЕРЫ . Решение астрономической задачи N тел на кластере из ГПУ (pdf) . Exploring weak scalability for FEM calculations on a GPU-enhanced cluster (pdf) . Using GPUs to Improve Multigrid Solver Performance on a Cluster (pdf) . ClawHMMER: A Streaming HMMer-Search Implementation (pdf) . Проект Folding@Home . Лаборатория Параллельных информационных технологий НИВЦ МГУ .
. # . Home . Services . Interaction . Calculate Hydrogen bond, Water bridges and Hydrophobic interaction for . Home Browse Download Help About Us . List of complexes . Pfam families . SCOP families . Interaction classes . Interaction modes . GO terms . ERROR! File was not found. NPIDB team 2003 - 2016 . text .
... Professors: Corresponding member of RAS S.A.Dobrolubov (water masses, ocean and atmosphere interaction), corresponding member of RAS S.K.Gulev (ocean and atmosphere interaction), academician of RAS A.S.Sarkisian (sea currents theory); . ... Data bases have been created: for Caspian Sea hydrological and hydrochemical observations in the second half of the XX century involving more than 70 thousands of oceanologic stations; for Black Sea about 60 thousands stations with thermohaline observations. ...
ON NONLINEAR DYNAMICS OF THE PENDULUM WITH PERIODICALLY VARYING LENGTH Anton BELYAKOV, Alexander SEYRANIAN a_belyakov@inbox.ru, seyran@imec.msu.ru Institute of Mechanics, Moscow State Lomonosov University, Michurinsky pr. ... Keywords: Pendulum of variable length, Stability of regular rotation, Tumbling chaos, Averaging method, Stability of limit cycle, Quasi-linear oscillatory system, Basin of attraction. ... Fig. ... Thus, the first instability domain takes the form (11) Fig. ... first three terms. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
European Research Council IDEAS Coordination and Support Action (CSA) Call identifier: ERC -2009-SUPPORT Guide for Applicants Version: 16 July 2008 The Guide is published by the ERC -DIS on http:// erc .europa.eu It can also be downloaded from the CORDIS page on http://cordis.europa.eu European Commission FP7 Specific Programme IDEAS ... Consequently, the ERC needs to be rigorous in evaluating the very best science and researchers and in selecting innovative and "high risk/high gain" projects. ...
WRF . ... NCEP/NCAR, . ... WRF (Weather Research and Forecasting Model), , ' -35' (-35) ' -36' (-36). ... 11.12.2007 . ... 100 % . ... 400 . ... Fels S.B., Schwarzkopf M.D. The simplified exchange approximation: a new method for radiative transfer calculations // Journal of the Atmospheric sciences. ... Vol. ... Janjic Z.I. The surface layer in the NCEP Eta model. ... Janjic Z.I. Nonsingular Implementation of the Mellor-Yamada Level 2.5 Scheme in the NCEP Meso model // NCEP Office Note. ...
[
Текст
]
Ссылки http://atm563.phys.msu.ru/rus/gidromet_public_html/trudy/thmc3440111.pdf -- 1474.5 Кб -- 14.03.2011 Похожие документы
... Three representative parameters characterizing the solar activity are sunspot number (W), 10.7cm radio solar flux (F10.7) and mean solar magnetic field value (SF). ... Practically persistent time series of these parameters are appropriate data sets for modelling and forecasting by means of Artificial Neural Networks (ANN). Methods of optimization of ANN input data sets and selection of training, testing and examination sets are discussed in the paper. ...
... The laser system in which an optoelectronic negative feedback is realized by means of a signal reflected from an intracavity Pockels cell polarizer is proposed and tested. The design provides flexible control over pulse train time structure. ... Stable self -mode-locking occurs due to time delay in feedback control system corresponding to light pulse passage through the Pockels cell at the moment of low intracavity losses. ... The scheme of discontinuous control in the laser is shown in Fig. ...
... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...
... В.И.Дмитриев Электромагнитные поля в неоднородных средах Изд-во Моск. ун-та, Москва 1969, с.131 . ... Изд-во 'Диалог-МГУ', 1997,с.168. ... Прикладная математика и информатика', Изд-во 'Диалог-МГУ', 1999,с. 68-77. ... Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г.,?7, с.5-18. ... В трудах 'Прикладная математика и информатика', ?2, Изд-во 'Диалог-МГУ', 1999,с. 5-17 . ... Сборник работ 'Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г., ?9, с. 46. ...