... Electronic journal Issue 4. 10 september 2004 Ulrich M. Sustainable Management of Natural Resources Introduction. ... To learn about the dynamics of natural resource management and the tragedy of the commons by means of a direct experience in the simulation game «NEW COMMONS GAME». ... 2) Tragedy of the commons and management of natural resources. ... The simulation game was followed by a short debriefing on the dynamics of the tragedy of the commons and natural resource management. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./ulrich.pdf -- 224.7 Кб -- 06.07.2014 Похожие документы
... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...
Doxyfile 1.4.6-NO # This file describes the settings to be used by the documentation system # doxygen (www.doxygen.org) for a project # # All text after a hash (#) is considered a comment and will be ignored # The format is: # TAG = value [value, .. ... USE_WINDOWS_ENCODING = YES # If the BRIEF_MEMBER_DESC tag is set to YES (the default) Doxygen will # include brief member descriptions after the members that are listed in # the file and class documentation (similar to JavaDoc). ... The default is NO. ...
MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...
О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...
[
Текст
]
Ссылки http://hit-conf.imec.msu.ru/2012/abstracts/AbstractKonyukhovLikhachev.doc -- 263.5 Кб -- 14.06.2015 Похожие документы
Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...
... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf -- 1261.4 Кб -- 13.09.2014 Похожие документы
... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...
Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics , . Online Services . ... SERVICES . ... You can't use main periodic table and drop-down list of databases at this page as menu without JavaScript support. But you can choose specific table or search form for each database from the list below. ... periodic table . search form . description . Nuclear Moments . ... Nuclear Reaction Database (EXFOR) . ... description Please, select database: . ... CDFE, 2003. ...
... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...
High level DQ control Vladimir Kulikovskiy Data/MC 3N trigger only. ... Colas presentaAon raAo seems to be different for different trigger setups. ... Wiki >Data >Quality Assessment (boYom) · It's a SeaTray module (antares qa used as a base) to be added in future to the producAon chain. ... Aafit charge sigma aachargesigma AafitChargePerOM RMS / MEAN * 100% Residual Residual Ame(ns) difference between real hit Ame and expected hit Ame from Aafit reconstructed track. ...
To use Microsoft Outlook Web access, browser settings must allow scripts to run. ... If your browser does not support scripts, you can download Microsoft Internet Explorer for access to Outlook Web Access. ... Select this option if you use Outlook Web Access on a public computer. ... This is a private computer . ... Use Outlook Web Access Light . ... Type the address for Outlook Web Access into the field, click Allow, and then click OK to save your changes. Connected to Microsoft Exchange . ...
Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...
MSU Scientific Library Physics Faculty Library . UDK: universal decimal classification . ... Bible at Gateway.com (available different languages) Bible Bible-center . The list of literature links . ... William Burroughs see also William Burroughs . Library Network . Kharuki Murakami Kharuki Murakami. ... Different funny stories . Perseus Project (Perseus is an evolving digital library, engineering interactions through time, space, and language.) ... The Public's Library . ...
Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...
[
Текст
]
Ссылки http://www.mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf -- 258.4 Кб -- 09.07.2007
[
Текст
]
Ссылки http://mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf -- 258.4 Кб -- 09.07.2007 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... About choir . ... Conductor . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Askerov Mirza-Aga Saftarovich , born in 1959, honored cultural worker of the Russian Federation, honored worked of the All-Russian Musical Society, candidate of pedagogical sciences. ... Since 1990 has been working with the Academic Choir of Moscow State University on the recommendation of professor V.V. Baranov, the honored cultural worker of the Russian Federation. ...
THE JOURNAL OF CHEMICAL PHYSICS 133, 144101 2010 Effective numbers of modes applied to analysis of internal dynamics of weakly bound clusters A. A. Rybakov,a E. D. Belega, and D. N. Trubnikov Department of ... Russia Received 11 June 2009; accepted 14 September 2010; published online 11 October 2010 The dependence of the volume of the chaotic component in the internal dynamics of triatomic van der Waals clusters on the angular ... When such difference is small, the regular motion disappears. ...