... Микс 193 A 131 A 171 A 211 A 304 A Корона Магнитограмма . 211 + 193 + 171 . Description . ... LASCO (Large Angle and Spectrometric Coronagraph)- инструмент на космическом аппарате SOHO, поставляющий изображения солнечной короны, на которых свет, идущий непосредственно от Солнца, заблокирован с помощью искусственного затмения, создаваемого самим аппаратом. ... The form and the location of the magnetospheric boundary are defined by pressure balance of the solar wind and geomagnetic field. ...

Еще в разделе: (Показать все результаты (>1233) - swx.sinp.msu.ru/ )

. Name . Last modified . Size . Description . about_center/ . 14-Sep-2013 14:31 . - . sections/ . 31-Oct-2007 14:46 . - . Apache/2.2.16 (Debian) Server at educenter.sinp.msu.ru Port 80

Еще в разделе: (Показать все результаты (>9) - educenter.sinp.msu.ru/ )

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>3) - www.bio.msu.ru/ )

• Master In Nanobiotechnology ? Биологический факультет МГУ

tppRENUM: 0.6.2 . tppMkTOP: 0.6.2 . Program allows you to renumber and rename atoms in your molecule in a nice way. Load PDB file for renumbering: . ... We strongly recommend you to read detailed description of TPPmktop functioning in TPPmktop description on ERG site . Please ensure, that your PDB file was made correctly. ... Load PDB file for making all-atom OPLS topology: . TPPRENUM runs: . TPPMKTOP runs: . ...

Еще в разделе: (Показать все результаты (>26) - erg.biophys.msu.ru/ )

• http://erg.biophys.msu.ru/erg/wordpress/wp-content/uploads/2010/04/jse_04_2_schmidt.pdf
• Quantum chemistry information page ERG Research Group: Лаборатория
• Building and plotting Fukui function with FireFly and PyMol ERG Research Group:

... 46. to give account of... 47. current (n.,adj.) . ... 57. complete v. adj. ,completely . ... 88. equal (v, adj), equally . ... 127. involve, involved (p.I, adj) . ... 134. to mean, meaning (less), means, by means of, mean (adj) . ... 145. reciprocal ( reciprocal relation) . ... 153. result, as a result, to result in / result from . ... 173a. reciprocal ( reciprocal relation) . ... Некоторые часто используемые слова: . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . ...

Еще в разделе: (Показать все результаты (>5) - www.students.chemport.ru/ )

• тест ?5 по английскому языку

... education . research . ... Functional Nanomaterials . ... Composite Nanomaterials Master?s Program . educational program . ... MSU and RAS leading scientists have devised fundamental courses (approx. 20% of the program) to provide essential knowledge in composites, a number of novel lecture and practical courses (approx. 50% of the program.) ... After completion of the program and defense of Master?s degree papers, students receive Master?s degrees from MSU. ...

Еще в разделе: (Показать все результаты (>12) - nano.msu.ru/ )

• Announcement about the admission to MSU Graduate School for a new Master?s

extra:model:main ]] . CompHEP . ... Please address any questions concerning models to their authors. Authors of a model keep all rights. Any CompHEP user may apply a model respecting conditions defined by the authors. ... Model ==== ** Model description ** * Name: modelname * Author: modelauthor * Short description: * Long description: see [[http://www.univ.com/author/auth|modelauthor]] * {{http://comphep.sinp.msu.ru/extra/model/auth.zip|auth.zip}}, 123KB * References: - ref 1 - ref 2 .. ...

Еще в разделе: (Показать все результаты (>96) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]
• news [CompHEP]

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• Nhunt: program for nucleic acid sequence similarity search

... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...

Еще в разделе: (Показать все результаты (>45) - sn.sai.msu.ru/ )

... Basic channels . ... To add new channel, You have to select one of the spectral operations from the Operations list, modify or set the operations parameters and select one (for unary operations) or two (for binary operations) parent spectral channels. ... Subset of parameters in parent channel parameters vector . ... Using the left mouse button, mark the speech frames in the recorded speech (white columns in the lower spectral window, corresponding to the parent channel of this speech detector). ...

Еще в разделе: (Показать все результаты (>75) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Strogalov Alexander Sergeevich :: Modeling
• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Magazine :: Web archive :: Volume 16, issue 1-4, 2012

Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Phase range for plots: -0.5 to 1.0 0.0 to 2.0 0.0 to 1.0 . ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... Two period search methods are currently implemented. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . ...

112. R.R.Newton, "Astronomical evidence..."

113. http://qi.phys.msu.ru/papers/2013-njp-15-035012.pdf

114. http://qilab.phys.msu.ru/papers/PhysRevA_70_052331.pdf

115. http://ics.org.ru/upload/iblock/972/RCD752.pdf

116. Index of /spravka/Magnetometers Database.files

117. http://www.innovation.msu.ru/english/neurokineticscasestudy.doc

118. MSU-LGCLL:: O.V. Kukushkina, A.A. Polikarpov, D.V. Khmelev - Authorship

119. Кафедра Исследования Операций

120. http://cosrad.sinp.msu.ru/experiments/tus/doc/global2007.pdf