... WRF (Weather Research and Forecasting Model) [9]. ... NOAH LSM (National Centers for Environmental Prediction, Oregon State University, Air Force, Hydrology Lab-NWS Land Surface Model) [3]. ... WRF ­ (Urban Canopy Model, UCM) [6] (Building Environment Parameterization, BEP) [8]. ... C ­ ( HA = r · HR + rw·Ha ). , r ­ ( UCM NOAH LSM « » , , , (, .) H = A H ­ , LSM +A HA , (, H ­ ; A , , ); A ­ , (, , ); HLSM ­ , NOAH LSM; HA ­ , UCM. ... 48 1 29 2007 00 . ... WRF) : - NOAH; UCM - ; BEP - . ...

Еще в разделе: (Показать все результаты (>5) - atm563.phys.msu.ru/ )

Optical Transport N etwork (OTN) Tutorial Disclaimer: This is a Tutorial. This is NOT a Recommendation! This tutorial has no standards significance. It is purely for educational purposes. In case of conflict between the material contained in the tutorial and the material of the relevant Recommendation the latter always prevails. This tutorial should NOT be used as a reference; only the relevant Recommendations can be referenced. Summary This document provides a tutorial for Optical Transport Network stand

Еще в разделе: (Показать все результаты (>4) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~bahmurov/course_realtime/papers/balashov_et_al_eucass2011_monitoring.doc
• http://lvk.cs.msu.su/~sveta/lecture1_formal_methods.pdf

Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>138) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/ihss/pdf/slovakia-2005.doc
• http://www.mgumus.chem.msu.ru/publication/2008/2008-kulikova-detoxifying.pdf
• http://www.mgumus.chem.msu.ru/publication/2010/2010-kazachkov-optimization.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

... Description . Catalog . ... In the Catalog, we publish equatorial (ЮБ 2000 , ЮД 2000 ) and galactic (l,b) coordinates of cluster centers derived as the position of overdensity in 2MASS catalog (Koposov et al. ... Distances, color-excesses and ages are the mean-square values calculated using all available evaluations from different color-magnitude diagrams. ... There are individual pages for every cluster where all available plots and parameters are published. ... 2002). ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI Open Star Clusters (SAI OCL) Catalog

... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...

Еще в разделе: (Показать все результаты (>2) - do.chem.msu.ru/ )

... Vol. ... Translated from Biofizika; Vol. ... CELL BIOPHYSICS Effects of Electric Field on Spatiotemporal Patterning in the Reaction-Diffusion System A. I. Lobanov-, T. Yu. ... Abstract-A model is proposed that describes electrodiffusion in the layer adjacent to the cell membrane. The model takes into account chemical reactions at the membrane, Coulomb interactions between particles, their random motion (diffusion), and the effect of an external electric field. ... BIOPHYSICS Vol. ...

Еще в разделе: (Показать все результаты (>37) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3347.pdf
• http://library.biophys.msu.ru/PDF/3345.pdf
• http://library.biophys.msu.ru/PDF/3340.pdf

... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

ISSN 1560-3547, Regular and Chaotic Dynamics, 2015, Vol. ... The Dynamics and Control of a Spherical Robot with an Internal Omniwheel Platform Yury L. Karavaev1* and Alexander A. Kilin 1 2** M. T. Kalashnikov Izhevsk State Technical University, ul. ... The problem of control of spherical robot motion along an arbitrary tra jectory is solved within the framework of a kinematic mo del and a dynamic mo del. ... To describe the motion of a spherical robot, we consider three coordinate systems. ... Vol. ...

Еще в разделе: (Показать все результаты (>113) - ics.org.ru/ )

• Institute of Computer Sciences - Publications

... Electronic journal Issue 4. 10 september 2004 Bonham G.M., Surin A. IP Videoconferencing in Graduate Professional Education: Collaborative Learning for Public Management Introduction. ... While technology offers a range of opportunities that a standard «chalk and talk» class could never match, questions about the educational value of the new digital media loom large. ... If so, how can technology more effectively promote student-centered learning? ... Collaborative IP Videoconferencing. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./leigh.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf

... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...

Еще в разделе: (Показать все результаты (>24) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University

... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt

... The traditional answer to this question is unequivocal: тАЬno, public scholarship cannot and should not exist.тАЭ To popularize knowledge is to simplify, and simplification risks the loss of nuance and complexity, the very essence of scholarly knowledge. ... The public sphere can know but a distorted version of scholarly knowledge. ... You need JavaScript enabled to view it. (with Summer School-2016 in the subject line) before April 25, 2016. ... Summer School Archives . ...

Еще в разделе: (Показать все результаты (>7) - discours.philol.msu.ru/ )

Dynamo Theory and Earth's Magnetic Field Paul Demorest May 21, 2001 1 Intro duction The Earth's magnetic field belongs in that class of physical phenomena which are commonplace yet also very complex. ... 3 Single Disc Dynamo Before we dive into the mess of equations and approximations that describe how fluid motion and magnetic field interact, it is useful to demonstrate a very simple system which exhibits dynamo action. ... A system without fluid motion cannot support a magnetic field indefinitely. ...

Еще в разделе: (Показать все результаты (>15) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/science/nosov/EGU2010_initial_condition.pdf
• http://ocean.phys.msu.ru/courses/stathyd/2001%20Ferrari%20et%20al.%2C%20The%20temperature-salinity%20relationship%20of%20the%20mixed%20layer.pdf

Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...

Еще в разделе: (Показать все результаты (>2) - genseq.fbb.msu.ru/ )

... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...

Еще в разделе: (Показать все результаты (>37) - nanofluidics.phys.msu.ru/ )

• Laboratory of Micro- and Nanofluidics

... The Symposium's three breakout sessions focused on risks from different perspectives: enterprise use, resource constrained environments, and combating malicious use. ... Specifically, a DNS collaborative response, awareness, technical training, and future DNS security, stability, and resiliency collaboration should take precedence within the issues selected for further study and implementation. ... Breakout Session Overview.. ... 30 Appendix F: Combating Malicious Use Breakout Session Guide Book .. ...

Еще в разделе: (Показать все результаты (>10) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )

... Scaliger sometimes forgot as anyone will when doing chronological computations whether he sought a current or a completed year, and therefore gave Julian dates that did not actually match the cyclical dates his computations had determined (e.g. eras 37,42, and 49). ... This table lists all the eras explicitly given as such by Scaliger, with their positions in the Julian Period and their dates in years BC or AD. ... To find a year in this era, subtract 296 from the date in the era of the Hegira. ...

Еще в разделе: (Показать все результаты (>87) - hbar.phys.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>88) - npidb.belozersky.msu.ru/ )