European Research Council IDEAS Coordination and Support Action (CSA) Call identifier: ERC -2009-SUPPORT Guide for Applicants Version: 16 July 2008 The Guide is published by the ERC -DIS on http:// erc .europa.eu It can also be downloaded from the CORDIS page on http://cordis.europa.eu European Commission FP7 Specific Programme IDEAS ... Consequently, the ERC needs to be rigorous in evaluating the very best science and researchers and in selecting innovative and "high risk/high gain" projects. ...

Еще в разделе: (Показать все результаты (>34) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/Work_programme_2011.pdf
• http://ideas.msu.ru/docs/ERC_work_programme_2010.pdf
• http://ideas.msu.ru/docs/work_programme_2012.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Comparison of protein phylogeny reconstruction methods

... L Сd , Pol a nd ABOUT EFFECTIVE MODES METHOD FOR DESCRIPTION OF INTERNAL DYNAMICS OF WEAKLY BOUND CLUSTERS Elena Belega, Evgeny Cheremukhin 1 , Dmitry Trubnikov Abstract: New approach to describe the internal dynamics of weakly bound clusters is presented. ... It is found that the number of active collective modes depends on the initial cluster excitation and that the internal energy is partitioned nonuniformly among the modes. ... Collective motion of oxygen atoms performs mostly in plane. ...

Еще в разделе: (Показать все результаты (>21) - beams.chem.msu.ru/ )

• http://beams.chem.msu.ru/doc/JCPSA613314144101_1.pdf
• http://beams.chem.msu.ru/sotrudniki/larin/PCCP1.pdf
• http://beams.chem.msu.ru/sotrudniki/larin/IJQCh_04.pdf

... Department of Computational mathematics and cybernetics , Lomonosov Moscow State University . ... Thesis title "Machine learning approach for automatic performance tuning of parallel program", supervisor Dr. Nina N. Popova. ... High-performance computing, automatic performance tuning, machine learning algorithms, evolutionary and bio-inspired programming, parallel algorithms in VLSI design . ... Algorithms and framework for automatic selection and tuning parameters of parallel sparse linear solvers....

Еще в разделе: (Показать все результаты (>7) - angel.cmc.msu.ru/ )

• Index of /~basrav/supercomp2010

... Average effective wavelengths and band widths for various sp ectra Lyrae spectrum f flat k е 1014 Hz 5386 ± 18 4.66 ± 0.04 5714 ± 12 4.1 6234.5 ± 0.5 1.03 5372 ± 18 4.69 ± 0.04 eff 2 Optical Filter ID 1 2 3 4 a Fo c -6 10 erg/cm2 s 12.55 ± 0.10 11.04 ± 0.01 2.77 ± 0.004 12.63 ± 0.10 fo d 6 10 photons/cm2 s 3.40 ± 0.02 3.18 ± 0.004 0.87 ± 0.002 3.42 ± 0.02 Power-law eff f 2 е 5746 ± 317 6197 ± 253 6305 ± 31 5736 ± 316 spectra pl k 1014 Hz 3.70 ± 0.26 3.14 ± 0.16 0.88 ± 0.01 3.70 ± 0.27 Table 1. ...

Еще в разделе: (Показать все результаты (>32) - master.sai.msu.ru/ )

• SAI Space Monitoring Laboratory
• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

News of PARALLEL.RU par-news на mail.parallel.ru . ... Разработка грид-сервиса управления заданиями ГридННС Pilot на основе архитектурного стиля REST . http ://agora.guru.ru/parallel ------------- НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / news / + Intel представляет секцию параллельное программирование конференции TechDays.ru. http ://www.techdays.ru/category/21.html + Georgia Institute of Technology создает Institute for Data and High Performance Computing ...

Еще в разделе: (Показать все результаты (>115) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #266 [27/05/2009]
• PARALLEL.RU - Новости, выпуск #268 [07/07/2009]
• PARALLEL.RU - Новости, выпуск #327 [30/05/2012]

. Name . Last modified . Size . Description . about_center/ . 14-Sep-2013 14:31 . - . sections/ . 31-Oct-2007 14:46 . - . Apache/2.2.16 (Debian) Server at educenter.sinp.msu.ru Port 80

Еще в разделе: (Показать все результаты (>9) - educenter.sinp.msu.ru/ )

• Index of /about_center/workplaces
• Index of /about_center
• Index of /sections

... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...

Еще в разделе: (Показать все результаты (>5) - margaret.imec.msu.ru/ )

• On Square Parachute Differential Equations

X Workshop on Particle Correlation and Femtoscopy 25-29 August, 2014 Higher flow harmonics and ridge effect in PbPb collisions with HYDJET ++ model Czech Technical University in Prague SINP MSU, Russia V.L. Korotkikh, I.P. Lokhtin, S.V. Petrushanko, A.M. Snigirev SINP MSU Gyulnara Eyyubova, Project OPVK CZ.1.07/2.3.00/30.0034 1 Outline HYDJET ++ model (hydro + jet ) Description of elliptic flow v 2 Triangular flow v3 and higher Phys. Comm. ... HYDJET++ 31 ...

Еще в разделе: (Показать все результаты (>55) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/nir/papers/PRD72001.pdf
• http://lav01.sinp.msu.ru/nir/papers/NIM_3000-LGD.pdf
• http://lav01.sinp.msu.ru/~igor/seminar/CorrFlow_In_AMPT_vlk.pdf

... Department of Mathematics, . Faculty of Physics, MSU . ... Differential equations . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Abstract differential equations with applications in mathematical physics . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Methods of finite differences in mathematical physics . ... Inverse problems in mathematical physics . ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>8) - math.phys.msu.ru/ )

... PHYSICAL INSTRUMENTS FOR ECOLOGY, MEDICINE, AND BIOLOGY Laser­Electron X-Ray Source for Medical Applications E. G. Bessonov, A. V. Vinogradov, and A. G. Tourianskii Lebedev Physical Institute, Russian Academy of Sciences, Leninskii pr. ... It includes two electron storage rings (E 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. ... Electrons can be injected into the storage rings singly or during several cycles through the injectors. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• http://miles.sinp.msu.ru/files/LEXG_SPIE_05.pdf
• Proposal of a Compact Repetitive Dichromatic X-ray Generator with Millisecond
• Laser-Electron X-Ray Source for Medical Applications | Проект ЭЛЛАРИ

... Chilingarian, I., Melchior, A.-L., Zolotukhin, I. 2010: Analytical approximations of K -corrections in optical and near-infrared bands , MNRAS, v. 405, p. 1409 (also arXiv:1002.2360) . ... Calculator . ... calculate spectral energy distributions , K-corrections calculator , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...

Еще в разделе: (Показать все результаты (>6) - kcor.sai.msu.ru/ )

• K-corrections calculator (version 2010)

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... BDRG . ... DEPRON . ELFIN-L . ... The satellite ?Mikhailo Lomonosov? is based on the platform of the spacecraft ?Kanopus-B? developed by the All-Russia reasearch and development institute of electromechanics named after Iosiphyan (VNIIEM). ... Scientific equipment will weight about 120 kg, while the total weight of the satellite will be about 450 kg. ...

Еще в разделе: (Показать все результаты (>16) - lomonosov.sinp.msu.ru/ )

• Scientific goals | Университетский спутник "Ломоносов"

Contemporary media environment is formed by dense concentration and interaction of cultures, languages, channels and modalities of communication. ... Across this new terrain, rich, exciting and risky, the new generation of media practitioners, teachers, researchers and public intellectuals is expected to navigate competently and creatively. ... Nor can the idea of intercultural communication be limited (as it was тАУ only recently) to relatively formal contact between established national cultures. ...

Еще в разделе: (Показать все результаты (>14) - discours.philol.msu.ru/ )

• Summer School Archives

... International Relations in Context of Global Processes - 17| ... GLOBAL ECONOMIC AND POLITICAL TRENDS Prof. Olga Y. Kornienko Economic literature survey Week 1 (4 academic hours ) 1) Current trends of global economy Week 2 (4 academic hours ) 2) Migration, population and globalization Week 3 (4 academic hours ) 3) Corporate culture and management: new trends Week 4 (4 academic hours ) 4) Development markets in global environment Week 5 (4 academic ... Models of the global world. ...

Еще в разделе: (Показать все результаты (>50) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf

BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...

Еще в разделе: (Показать все результаты (>2) - muscle.imec.msu.ru/ )

О кафедре . ... Наглядная и компью терная геометрия и топология . ... Г.В.Носовский. ... Математические заметки, т. 33, вып. 2, 1985, с. 325-333. ... Об условиях, возникающих при оценке производных решений стохастических дифференциальных уравнений в римановых пространствах.. ... Тезисы Бакинской международной конференции по топологии и ее приложениям. ... В.В.Калашников, Г.В.Носовский, А.Т.Фоменко. ... Г.В.Носовский, А.Т.Фоменко. ... Вып. ... А.А.Голованов, Д.П.Ильютко, Г.В.Носовский, А.Т.Фоменко. ...

Еще в разделе: (Показать все результаты (>44) - dfgm.math.msu.su/ )

... These approaches were: (1) laser photobleaching of a path through the centrosome; (2) direct observation of microtubules in centrosome-containing cytoplasts; (3) GFP-CLIP-170 expression as a marker for microtubule plus end growth; and (iv) sequential subtraction analysis. ... This result signifies that most MTs persistently grow from their time of birth at the centrosome until their plus end nears the cell margin. ... Growth of nascent MTs in CHO cells was not only persistent but rapid. ...

Еще в разделе: (Показать все результаты (>28) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/jcs99.pdf
• http://cellmotility.genebee.msu.ru/html/articles/Vorobjev03.pdf
• http://cellmotility.genebee.msu.ru/html/articles/vorobjev2002CBI.pdf

... О межфакультетских курсах МГУ . Видео МФК . ... Канал МГУ на YouTube . ... Комментарии Дата Просмотры Лайки Комментарии Упорядочить по возрастанию . ... x25BA; Кинофонд МГУ (95) . ... x25BA; Фильмы о МГУ (5) . ... x25BA; СУНЦ МГУ (5) . ... x25BA; МФК (1084) . ... x25BA; Механико-математический факультет (5) . ... x25BA; Социологический факультет (13) . ... x25BA; Факультет журналистики (11) . ... x25BA; Факультет наук о материалах (7) . ... Copyright 2016 ї Видеоархив МГУ имени М.В.Ломоносова . ...

Еще в разделе: (Показать все результаты (>176) - media.msu.ru/ )

• Университетские субботы (МГУ-школе) | Видеоархив МГУ имени М.В.Ломоносова

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:51:07 Sun , 19 Dec 2010 19:46:39 GMT Daniil Alexeyevsky me.dendik@тАж [40:94945f11c78d] * snake.py ( modified ) snake.Snake.fill: tail takes precedence over body head Sun , 19 Dec 2010 19:45:31 GMT Daniil Alexeyevsky me.dendik@тАж [39:2de0dd929b1c] * snake.py ( modified ) implemented snake.Rule.rotate; untested yet Sun , 19 Dec 2010 19:34:04 ...

Еще в разделе: (Показать все результаты (>1413) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/snake/log/?format=changelog&rev=39%3A2de0dd929b1c&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/snake/log/?format=changelog&rev=40%3A94945f11c78d&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/snake/log/?format=changelog&rev=2de0dd929b1c68e40949b7acdba111aaa8c1d3a9&limit=100&mode=stop_on_copy