... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>27) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Relational ENSDF
• CDFE => Online Services => NSR Search Engine
• CDFE provides the major photonuclear databases. Online Services.

Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>111) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/ihss/board/ihssproposedbylawsoct2006.pdf
• http://www.mgumus.chem.msu.ru/publication/2012/2012-karpiouk-self.pdf
• http://www.mgumus.chem.msu.ru/publication/2013/2013-Kostyukevich-etal.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Comparison of protein phylogeny reconstruction methods

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... Mathematical Reviews MR2056325 . What makes this new book an outstanding contribution to stability theory? First of all, the book succeeds in bringing qualitative results of the famous Russian school of applied mathematics to stability theory, making these results quantitative and applicable. ... Reviewed by Professor Wolfhard Kliem . ...

Еще в разделе: (Показать все результаты (>26) - mailybaev.imec.msu.ru/ )

ISSN 1560-3547, Regular and Chaotic Dynamics, 2015, Vol. ... The Dynamics and Control of a Spherical Robot with an Internal Omniwheel Platform Yury L. Karavaev1* and Alexander A. Kilin 1 2** M. T. Kalashnikov Izhevsk State Technical University, ul. ... The problem of control of spherical robot motion along an arbitrary tra jectory is solved within the framework of a kinematic mo del and a dynamic mo del. ... To describe the motion of a spherical robot, we consider three coordinate systems. ... Vol. ...

Еще в разделе: (Показать все результаты (>117) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/704/186-the-self-propulsion-of-a-body-with-moving-internal-masses-in-a-viscous-fluid_ru.pdf
• http://ics.org.ru/upload/iblock/970/119-some-comments-to-the-paper-by-a-m-perelomov-quot-a-note-on-geodesics-on-ellipsoid-quot-rcd-2000-5-1-_ru.pdf
• http://ics.org.ru/upload/iblock/7bb/RCD701.pdf

... Here we construct a general approach to formulating and using embedding formulae, we do this using complementary approaches: overly singular states, and a physical interpretation in terms of sources. ... For example, if the obstacle is a planar crack in the medium, then the auxiliary problems are associated with the excitation of the field by a point source located asymptotically close to the edge of the crack. ... That is, has overly singular behaviour at the edge. ...

Еще в разделе: (Показать все результаты (>42) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/inclined.pdf
• http://acoustics.phys.msu.su/conf2002.htm
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/pseudodif.pdf

ISSUE 1 RUSSIA U.S. BILATERAL ON CYBERSECURITY CRITICAL TERMINOLOGY FOUNDATIONS APRIL 2011 The Russia U.S. Bilateral on Cybersecurity ­ Critical Terminology Foundations Issue 1 The principle editors of this document are: Karl Frederick Rauscher, EastWest Institute and Valery Yaschenko, Information Security Institute of Moscow State University. ... INFORMATION AND CYBER .. ... Scientific Adviser to the Director of the Lomonosov Moscow State University Institute of Information Security Issues. ...

Еще в разделе: (Показать все результаты (>10) - iisi.msu.ru/ )

... The traditional answer to this question is unequivocal: тАЬno, public scholarship cannot and should not exist.тАЭ To popularize knowledge is to simplify, and simplification risks the loss of nuance and complexity, the very essence of scholarly knowledge. ... The public sphere can know but a distorted version of scholarly knowledge. ... You need JavaScript enabled to view it. (with Summer School-2016 in the subject line) before April 25, 2016. ... Summer School Archives . ...

Еще в разделе: (Показать все результаты (>4) - discours.philol.msu.ru/ )

• Events

International Symposium - Speciation in Ancient Lakes , SIAL III - Irkutsk, September 2-7, 2002 65 Berliner PalДobiologische Abhandlungen 4 65 - 75 Berlin 2003 Achievements and Limitations of the K-Ar and 40Ar/39Ar Methods: What's in It for Dating the Quaternary Sedimentary Deposits? ... It is shown that the major problem for K-Ar method is in the plausible inequality of initially trapped argon isotopic composition in minerals of volcanic origin to the atmospheric 40 36 40 39 Ar/ Ar ratio of 295.5. ...

Еще в разделе: (Показать все результаты (>92) - hbar.phys.msu.ru/ )

• http://hbar.phys.msu.ru/gorm/fomenko/fomenko4.pdf
• newtrev2.htm
• Appendix: Scaliger's List of Eras

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Еще в разделе: (Показать все результаты (>40) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2013/12/Luce_Moscow_2013_small.pdf
• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...

Еще в разделе: (Показать все результаты (>30) - nanofluidics.phys.msu.ru/ )

... distant.msu.ru . ... Видеоархив МГУ . Список курсов . ... Курсы факультетов МГУ . Факультет мировой политики . ... Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1272 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1516 Курсы для школьников / Курсы от школ-партнеров / ГБОУ СОШ ?1159 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Школа ?2065 Курсы для школьников / Курсы от ... Открытые курсы МГУ . ...

Еще в разделе: (Показать все результаты (>2) - distant.msu.ru/ )

... The surface mixed layer of the ocean is often characterized by density compensation between the horizontal temperature and salinity gradients. ... The coupling arises through a nonlinear diffusion operator proportional to the buoyancy gradient, which parameterizes the combined effect of slumping and mixing of small-scale horizontal buoyancy gradients. ... Mesoscale stirring will create small-scale temperature and salinity gradients by stretching and folding the large scale thermohaline patterns. ...

Еще в разделе: (Показать все результаты (>12) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/geo/lectures-addons/15/2001%20Demorest%2C%20Dynamo%20theory%20and%20Earth's%20magnetic%20field%20.pdf

... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...

115. http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf

116. http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc

117. http://lib.sinp.msu.ru/static/tutorials/52_p4.pdf